Acoloithus rectarius

Dyar, 1898 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Zygaenidae/Acoloithus

At a glance

Occurrence records14

Data sources6

Biological traits0

DNA specimens8

eDNA detections5

Sources6 archives

Databases and archives Acoloithus rectarius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acoloithus rectarius is een vlinder uit de familie van de bloeddrupjes (Zygaenidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1898 door Dyar.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acoloithus rectarius has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

1Amostly conserved

31Tmostly conserved

49Cmostly conserved

88Avariable

181Amostly conserved

187Tvariable

197Cvariable

202Cvariable

295Cvariable

316Gvariable

364Cvariable

400Tvariable

401Cvariable

412Cvariable

466Avariable

469Cvariable

513Gvariable

514Tvariable

533Tvariable

553Avariable

622Gvariable

AACACTTTACTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCCTTAAGATTATTAATTCGAGCTGAATTAGGAACTCCAGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes3

BINs2

Most divergent pair3.2%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acoloithus novaricussame genus7.4%Acoloithus falsariussame genus7.9%Phocoderma velutinasame order10.2%Scopula acidaliasame order10.8%Cynaeda forsterisame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type14 records

Wild obs. + sensor3

Museum / vouchered11

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	5
East Lansing, US	3
ASUlocation not on record	1

3 institutions · 9 of 11 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Acoloithus rectarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.0–24.0

Seasonal swing summer↔winter17.4 °C

Max temp (day)30.4 °C 29.2–30.4

Min temp (night)17.9 °C 17.4–17.9

Precipitation133 mm/mo 133–135

Air humidity51.1 % 51.1–54.2

Moisture balance-39.0 mm/mo -39.0–-25.3

Vapour deficit1,461 Pa 1,295–1,461

Wind speed2.20 m/s 2.00–2.20

Cloud cover15.7 % 15.7–17.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)