Acoloithus falsarius

Clemens, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Zygaenidae/Acoloithus

At a glance

Occurrence records709

Data sources7

Biological traits0

DNA specimens21

eDNA detections13

Sources7 archives

Databases and archives Acoloithus falsarius's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility709 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF709 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD21 specimens

01Narrative

Acoloithus falsarius, or Clemens' false skeletonizer, is a moth species in the zygaenid subfamily Procridinae. The species occurs in North America and was described by James Brackenridge Clemens in 1860. A. falsarius has Hodges number 4629 and is the type species of genus Acoloithus. Larvae are known to feed on Vitis spp. and Ampelopsis spp.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acoloithus falsarius has left across the world's sequence archives.

At a glance

DNA specimens21

BINs4

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 58 variable positions, in barcode order

22Amostly conserved

31Amostly conserved

59Cmostly conserved

61Amostly conserved

67Amostly conserved

74Cmostly conserved

79Amostly conserved

81Cvariable

82Amostly conserved

85Cmostly conserved

88Gmostly conserved

100Amostly conserved

103Cvariable

106Tvariable

127Cvariable

142Tvariable

178Tmostly conserved

187Tmostly conserved

197Tmostly conserved

205Avariable

212Tmostly conserved

220Tvariable

229Amostly conserved

238Tvariable

241Tvariable

271Tvariable

278Cvariable

287Cvariable

304Cvariable

337Gmostly conserved

358Tmostly conserved

367Cvariable

368Amostly conserved

385Tmostly conserved

400Amostly conserved

401Cvariable

412Amostly conserved

457Tmostly conserved

460Tmostly conserved

463Tvariable

499Tvariable

508Gmostly conserved

533Cmostly conserved

539Tmostly conserved

541Amostly conserved

553Amostly conserved

556Tvariable

557Cmostly conserved

559Tmostly conserved

562Avariable

574Tmostly conserved

586Avariable

595Cmostly conserved

601Cvariable

613Tmostly conserved

622Cmostly conserved

634Tvariable

652Tmostly conserved

AACACTTTATTTTATTTTTGGAATTTGATCAGGAATAGTTGGAACATCATTAAGATTACTAATTCGAGCTGAACTAGGAACACCCGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes8

BINs4

Most divergent pair4.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acoloithus novaricussame genus3.6%Acoloithus rectariussame genus7.9%Ypsolopha alpellasame order10.3%Parasa hilarulasame order10.6%Eclipsiodes crypsixanthasame order10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type709 records

Wild obs. + sensor599

Museum / vouchered110

Range

Area of Occupancy AOO1 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 269≤1 km 100≤10 km 26>10 km 60

455 georeferenced · 144 without coordinates

Open the mapobservation + sensor599

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 25>10 km 9

36 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	39
CUlocation not on record	16
University of California, Davislocation not on record	16
New Haven, US	12
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
Georgia Museum of Natural Historylocation not on record	6
East Lansing, US	3
University of Alberta Museums (UAM)location not on record	2
Cambridge, US	1
King Saud Universitylocation not on record	1
ASUlocation not on record	1
UDlocation not on record	1
University of Central Floridalocation not on record	1

13 institutions · 105 of 110 vouchered records shown · 5 without an institution code

09Environmental DNA13 detections

Where the DNA of Acoloithus falsarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

BeachMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 21.4–25.2

Seasonal swing summer↔winter23.3 °C

Max temp (day)27.7 °C 24.5–28.4

Min temp (night)18.0 °C 16.3–23.0

Precipitation106 mm/mo 86.3–119

Air humidity59.4 % 57.9–60.8

Moisture balance-50.0 mm/mo -94.7–-29.3

Vapour deficit1,139 Pa 1,039–1,251

Wind speed3.30 m/s 1.50–5.70

Cloud cover32.5 % 30.0–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)