Acmopolynema varium

(Girault, 1917) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Mymaridae/Acmopolynema

At a glance

Occurrence records32

Data sources6

Biological traits0

DNA specimens49

eDNA detections57

Sources6 archives

Databases and archives Acmopolynema varium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF32 records

Environmental DNA1 datasets · 4 countries57 detections

DNA & barcodingBOLD49 specimens

01Narrative

Acmopolynema varium is een vliesvleugelig insect uit de familie Mymaridae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1917 door Girault.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmopolynema varium has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes2

eDNA detections57

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

58Tmostly conserved

78Amostly conserved

84Tmostly conserved

334Gmostly conserved

342Tmostly conserved

370Gmostly conserved

489Gmostly conserved

492Amostly conserved

549Tmostly conserved

624Amostly conserved

ATATTATATTTTATTTTTGGTTTATGATCTGGATTTTTAGGATTATCTTTAAGAATATTAATTCGATTAGAATTAGGAATACCTAATTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes16

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anagrus daaneisame family10.2%Anagrus flaviapexsame family10.4%Anagrus ustulatussame family10.4%Anaphes listronotisame family11.7%Gonatocerus triguttatussame family11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type32 records

Wild obs. + sensor2

Museum / vouchered30

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 15

16 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	15
Wuzhou, CN	9
	5
Essig Museum of Entomologylocation not on record	1

4 institutions · 30 of 30 vouchered records shown

09Environmental DNA57 detections

Where the DNA of Acmopolynema varium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 11.8–23.4

Seasonal swing summer↔winter16.4 °C

Max temp (day)23.2 °C 16.5–28.1

Min temp (night)9.20 °C 6.60–19.9

Precipitation31.7 mm/mo 7.00–128

Air humidity53.3 % 41.8–62.2

Moisture balance-67.8 mm/mo -158–69.4

Vapour deficit789 Pa 589–1,296

Wind speed2.30 m/s 1.40–5.10

Cloud cover35.2 % 15.4–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)