Acmaeodera tubulus

(Fabricius, 1801) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeodera

At a glance

Occurrence records2 208

Data sources8

Biological traits0

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Acmaeodera tubulus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 208 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 208 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acmaeodera tubulus is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeodera tubulus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

178Amostly conserved

268Tmostly conserved

283Cmostly conserved

318Cmostly conserved

583Amostly conserved

586Tmostly conserved

613Tmostly conserved

616Tmostly conserved

628Avariable

CACCCTTTACTTCATCTTTGGAGCATGATCTGGAATAGTAGGAACTGCCCTTAGACTTCTCATCCGAGCAGAGCTTGGTAACCCAGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes3

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acmaeodera scalarissame genus15.8%Acmaeodera decipienssame genus15.8%Acmaeodera amabilissame genus16.1%Acmaeodera flavomarginatasame genus16.6%Acmaeodera opaculasame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 208 records

Wild obs. + sensor1 833

Museum / vouchered375

Range

Area of Occupancy AOO5 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 806≤1 km 408≤10 km 71>10 km 179

1 464 georeferenced · 369 without coordinates

Open the mapobservation + sensor1 833

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 46≤10 km 46>10 km 30

122 georeferenced · 253 without coordinates

Open the institutions mapphysical evidence375

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	75
Lexington, US	65
Wuzhou, CN	44
University of Central Floridalocation not on record	42
University of Guelphlocation not on record	33
College Station, US	27
Lubbock, US	21
University of Alabamalocation not on record	18
University Park, US	10
Lake Placid, US	10
Cambridge, US	5
US	4
Albany, US	3
Denver, US	3
WIlocation not on record	3
OSUClocation not on record	3
Natural History Museum of Utahlocation not on record	2
LULlocation not on record	2
Montgomery, US	1
University of Tennessee at Chattanoogalocation not on record	1
CUlocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
UDlocation not on record	1

23 institutions · 375 of 375 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Acmaeodera tubulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.2–22.2

Seasonal swing summer↔winter22.6 °C

Max temp (day)27.2 °C

Min temp (night)18.2 °C

Precipitation137 mm/mo

Air humidity57.9 %

Moisture balance-53.5 mm/mo

Vapour deficit1,122 Pa

Wind speed5.80 m/s

Cloud cover37.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acmaeodera tubulus

At a glance

Sources8 archives

At a glance

Record type2 208 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 208 records