Acmaeodera pilosellae

(Bonelli, 1812) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeodera

At a glance

Occurrence records547

Data sources10

Biological traits0

DNA specimens8

eDNA detections5

Sources10 archives

Databases and archives Acmaeodera pilosellae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility547 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF547 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Acmaeodera pilosellae ist ein Käfer aus der Familie der Prachtkäfer und der Unterfamilie Polycestinae. Die Gattung Acmaeodera ist in Europa mit 25 Arten vertreten, die in drei Untergattungen eingeteilt werden. Acmaeodera pilosellae wird zur Untergattung Acmaeodera gerechnet, die in Europa mit fünf Arten vertreten ist. Die Art Acmaeodera pilosellae kommt in Europa nur in der Unterart Acmaeodera pilosellae pilosellae vor. Im Internet findet man auch den deutschen Namen Welliggefleckter Prachtkäfer. x90pxx90px Abb. 1: Zwei verschiedene Zeichnungen x90px x50px Abb. 2: Vorderansicht Abb. 3: Seitenansicht Abb. 4: Paarung

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeodera pilosellae has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes3

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 103 variable positions, in barcode order

1Avariable

19Cmostly conserved

31Amostly conserved

40Tmostly conserved

46Amostly conserved

49Tmostly conserved

55Cmostly conserved

59Cmostly conserved

61Tmostly conserved

76Gmostly conserved

79Tvariable

88Amostly conserved

91Cmostly conserved

106Cmostly conserved

118Tmostly conserved

127Amostly conserved

130Avariable

133Amostly conserved

136Tmostly conserved

145Tmostly conserved

157Cmostly conserved

169Tmostly conserved

181Cmostly conserved

190Gmostly conserved

193Tmostly conserved

206Cmostly conserved

217Cmostly conserved

226Tmostly conserved

232Amostly conserved

259Cmostly conserved

265Tmostly conserved

268Amostly conserved

283Cmostly conserved

292Tmostly conserved

302Gmostly conserved

307Amostly conserved

316Amostly conserved

328Tmostly conserved

334Tmostly conserved

337Tmostly conserved

340Tmostly conserved

346Tmostly conserved

355Tmostly conserved

373Amostly conserved

379Cmostly conserved

382Tmostly conserved

385Tvariable

388Gmostly conserved

394Cmostly conserved

397Tmostly conserved

400Amostly conserved

401Cmostly conserved

403Tmostly conserved

406Cvariable

409Gmostly conserved

412Tmostly conserved

421Amostly conserved

427Tmostly conserved

439Tmostly conserved

442Tmostly conserved

454Tmostly conserved

463Cmostly conserved

472Amostly conserved

473Gmostly conserved

474Tmostly conserved

481Amostly conserved

484Amostly conserved

487Amostly conserved

500Cmostly conserved

505Tmostly conserved

508Tmostly conserved

511Gmostly conserved

514Gmostly conserved

517Avariable

520Cmostly conserved

530Tmostly conserved

535Amostly conserved

538Tmostly conserved

541Tmostly conserved

542Tmostly conserved

547Tmostly conserved

550Amostly conserved

565Amostly conserved

568Tmostly conserved

574Cvariable

583Tvariable

589Cmostly conserved

595Tmostly conserved

598Tmostly conserved

604Cmostly conserved

607Avariable

613Cmostly conserved

619Tmostly conserved

622Tmostly conserved

628Gmostly conserved

631Amostly conserved

634Tmostly conserved

637Tmostly conserved

640Tmostly conserved

643Tvariable

646Cvariable

649Amostly conserved

653Tmostly conserved

AACACTATACTTCATCTTCGGTGCTTGATCAGGAATAGTTGGAACAGCTCTAAGCCTCCTTATTCGAGCAGAATTGGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.6%

Haplotypes4

BINs2

Most divergent pair14.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phaenops cyaneasame family16.3%Anaspis marginicollissame order16.4%Phaenops fulvoguttatasame family16.7%Acmaeodera bipunctatasame genus16.8%Perotis lugubrissame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Acmaeodera pilosellae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Karagyan G, Lachowska D, Kalashian M (2012) Karyotype analysis of four jewel-beetle species (Coleoptera, Buprestidae) detected by standard staining, C-banding, AgNOR-banding and CMA3/DAPI staining. Comparative Cytogenetics 6: 183-197. ↗

08Occurrence & distribution

Record type547 records

Wild obs. + sensor487

Museum / vouchered57

Other3

Origin

Native13

Range

Area of Occupancy AOO1 472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 101≤1 km 98≤10 km 189>10 km 3

391 georeferenced · 96 without coordinates

Open the mapobservation + sensor487

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 10≤10 km 10

20 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	21
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	11
Natural History Museum Rotterdamlocation not on record	5
MZLUlocation not on record	5
Vitoria, ES	2
Denver, US	1
Museo Zoologico La Specolalocation not on record	1
Helsinki, FI	1

8 institutions · 47 of 57 vouchered records shown · 9 without an institution code

09Environmental DNA5 detections

Where the DNA of Acmaeodera pilosellae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter16.2 °C

Max temp (day)18.5 °C

Min temp (night)14.9 °C

Precipitation55.2 mm/mo

Air humidity62.8 %

Moisture balance-51.6 mm/mo

Vapour deficit758 Pa

Wind speed3.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)