Acizzia uncatoides

(Ferris & Klyver, 1932) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Psyllidae/Acizzia

At a glance

Occurrence records318

Data sources7

Biological traits0

DNA specimens409

eDNA detections403

Sources7 archives

Databases and archives Acizzia uncatoides's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility318 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI403 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics409 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF318 records

Environmental DNA1 datasets · 6 countries403 detections

DNA & barcodingBOLD409 specimens

01Narrative

Acizzia uncatoides is a species of psyllid native to Australia where it feeds primarily on Acacia (especially Acacia melanoxylon) and some Albizia species. It is present in many parts of the world where it infests these plant species, presumably introduced with the plants. It is not generally regarded as a pest species although it can proliferate to high numbers. Generalist psyllid predators also feed on this species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding409 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acizzia uncatoides has left across the world's sequence archives.

At a glance

DNA specimens409

BINs2

Marker genes5

eDNA detections403

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus385 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

CTATATTTTATTTTTGGGATTTGAGCAGGATTCATAGGATTATCTTTAAGATTAATCATTCGACTTGAATTAAGTCAATCTTCTCCTCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 65 variants.

Diversity (π)0.42%

Haplotypes65

BINs2

Most divergent pair16.4%

S.AmericaN.AmericaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acizzia jamatonicasame genus15.4%Diclidophlebia fremontiaesame order16.9%Acizzia acaciaebaileyanaesame genus17.2%Trioza urticaesame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S18S-5PCYTB

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_038146 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type318 records

Wild obs. + sensor111

Museum / vouchered207

Origin

Introduced160

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 39≤1 km 39≤10 km 7>10 km 10

95 georeferenced · 16 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 160≤10 km 5

165 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UAclocation not on record	160
University of Hawaii Insect Museumlocation not on record	7
BDClocation not on record	6
PDKlocation not on record	5
Centre for Biodiversity Genomicslocation not on record	5
Essig Museum of Entomologylocation not on record	5
Natural History Museum Bucharestlocation not on record	3
The University of Hawaii Insect Museumlocation not on record	2
BDC, NHMBlocation not on record	2
San Francisco, US	1
California Academy of Scienceslocation not on record	1
ULLlocation not on record	1
DMPClocation not on record	1

13 institutions · 199 of 207 vouchered records shown · 8 without an institution code

09Environmental DNA403 detections

Where the DNA of Acizzia uncatoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found403

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 403 detections have coordinates

Open the map6 countries0

3. Shrubland|3.8. Mediterranean-type Shrubby…1. Forest & WoodlandForest3. Shrubland | 3.5. Subtropical/Tropical Dry…14. Artificial - Terrestrial|14.5 Urban AreasUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.2–12.9

Seasonal swing summer↔winter0.7 °C

Max temp (day)17.0 °C 15.9–17.9

Min temp (night)8.80 °C 8.40–9.50

Precipitation72.2 mm/mo 49.6–134

Air humidity64.8 % 59.7–66.9

Moisture balance-45.4 mm/mo -68.4–34.5

Vapour deficit503 Pa 478–596

Wind speed3.40 m/s 3.20–4.20

Cloud cover34.0 % 17.3–71.7

CHELSA 1981–2010, ~9 km grid, at location & month of 387 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)