Acizzia acaciaebaileyanae

(Froggatt, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Psyllidae/Acizzia

At a glance

Occurrence records48

Data sources7

Biological traits0

DNA specimens592

eDNA detections1

Sources7 archives

Databases and archives Acizzia acaciaebaileyanae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics592 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD592 specimens

01Narrative

Acizzia acaciaebaileyanae is a psyllid common on Acacia baileyana, a popular garden specimen. The psyllid and its host plant are native to Australia, but both are now widespread where the plant has been introduced. The psyllid can reproduce to very high numbers, but appears not to damage the plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding592 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acizzia acaciaebaileyanae has left across the world's sequence archives.

At a glance

DNA specimens592

BINs1

Marker genes2

eDNA detections1

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus588 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

358Tmostly conserved

435Gvariable

AACACTCTACTTCATTTTCGGAATTTGGGCAGGATTCGTAGGGTTATCGCTAAGATTAATTATCCGACTCGAGCTCAGCCAATCATCGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes8

BIN1

Most divergent pair0.46%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acizzia uncatoidessame genus17.2%Acizzia jamatonicasame genus17.4%Trioza laurisilvaesame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type48 records

Wild obs. + sensor29

Museum / vouchered19

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 10≤10 km 4

14 georeferenced · 15 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 9

9 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	9
Geneva, CH	6
BDClocation not on record	1
Natural History Museum Bucharestlocation not on record	1

4 institutions · 17 of 19 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Acizzia acaciaebaileyanae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)