Acherontia lachesis

Fabricius, 1798 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Acherontia

At a glance

Occurrence records2 360

Data sources7

Biological traits0

DNA specimens61

eDNA detections57

Sources7 archives

Databases and archives Acherontia lachesis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 360 records

Environmental DNA1 datasets · 12 countries57 detections

DNA & barcodingBOLD61 specimens

01Narrative

Acherontia lachesis, the greater death's head hawkmoth or bee robber, is a large (up to 13 cm wingspan) sphingid moth found in India, Sri Lanka and much of the Oriental region. It is one of the three species of death's-head hawkmoth genus, Acherontia. The species was first described by Johan Christian Fabricius in 1798. It is nocturnal and very fond of honey; they can mimic the scent of honey bees so that they can enter a hive unharmed to get honey. Their tongue, which is stout and very strong, enables them to pierce the wax cells and suck the honey out. This species occurs throughout almost the entire Oriental region, from India, Pakistan and Nepal to the Philippines, and from southern Japan and the southern Russian Far East to Indonesia, where it attacks colonies of several different honey bee species. It has recently become established on the Hawaiian Islands. Larva (2) and pupa (2a) of Acherontia lachesis

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acherontia lachesis has left across the world's sequence archives.

At a glance

DNA specimens61

BINs2

Marker genes1

eDNA detections57

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

46Cmostly conserved

88Amostly conserved

235Cmostly conserved

340Tmostly conserved

349Tmostly conserved

364Cmostly conserved

367Tmostly conserved

386Tmostly conserved

499Cmostly conserved

542Tmostly conserved

559Gvariable

589Tmostly conserved

610Cmostly conserved

643Tvariable

646Tmostly conserved

658Cmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACCTCACTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes9

BINs2

Most divergent pair2.1%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acherontia styxsame genus4.3%Acherontia atropossame genus7.3%Kentrochrysalis hebertisame family8.5%Kentrochrysalis sieversisame family8.9%Eutelia fulvigriseasame order9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_067725 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~0.53 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.53 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type2 360 records

Wild obs. + sensor2 179

Museum / vouchered181

Range

Area of Occupancy AOO5 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 579≤1 km 341≤10 km 188>10 km 182

1 290 georeferenced · 889 without coordinates

Open the mapobservation + sensor2 179

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 3≤1 km 3≤10 km 4>10 km 3

13 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museum of Natural Sciencelocation not on record	31
tesrilocation not on record	27
Chiba, JP	26
FACTlocation not on record	16
Natural History Museum Rotterdamlocation not on record	16
Helsinki, FI	9
Tokushima, JP	6
Natural History Museum of Utahlocation not on record	4
Bavarian State Collection of Zoologylocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
New Haven, US	3
Toronto, CA	3
Toyota city nature sanctuarylocation not on record	3
South Kensington, GB	2
KCMNlocation not on record	2
ZSMlocation not on record	2
Auckland, NZ	2
National Institute for Biotechnology and Genetic Engineeringlocation not on record	2
Tartu, EE	2
Uniwersytet Łódzkilocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Hiwa Museum of Natural Historylocation not on record	1
Denver, US	1
ZMAAlocation not on record	1
Itami Shi, JP	1
Gifu prefectural Museumlocation not on record	1

27 institutions · 173 of 181 vouchered records shown · 8 without an institution code

09Environmental DNA57 detections

Where the DNA of Acherontia lachesis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 19.7–26.5

Seasonal swing summer↔winter2.50 °C

Max temp (day)26.8 °C 21.6–29.8

Min temp (night)22.5 °C 15.2–24.7

Precipitation386 mm/mo 38.4–500

Air humidity70.0 % 61.6–73.4

Moisture balance256 mm/mo -60.9–359

Vapour deficit959 Pa 622–1,266

Wind speed1.60 m/s 1.10–2.80

Cloud cover45.4 % 22.9–68.8

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acherontia lachesis

At a glance

Sources7 archives

At a glance

At a glance

When this lineage existed

Record type2 360 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 360 records