Acericerus ribauti

Nickel & Remane, 2002 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Acericerus

At a glance

Occurrence records1 746

Data sources6

Biological traits0

DNA specimens6

eDNA detections0

Sources6 archives

Databases and archives Acericerus ribauti's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 746 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 746 records

DNA & barcodingBOLD6 specimens

01Narrative

Acericerus ribauti, Weibchen Acericerus ribauti, Weibchen Die Ribaut-Winkerzikade (Acericerus ribauti) ist eine Zwergzikade aus der Unterfamilie der Winkerzikaden (Idiocerinae). Die Zikadenart wurde nach dem französischen Entomologen Henri Ribaut benannt.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acericerus ribauti has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

626Gmostly conserved

632Tmostly conserved

CAATATATTTTATTTTTGGTATTTGATCAGGTATAGTTGGAATAATGCTAAGTATAATTATCCGTATAGAACTATCACAACCTGGACCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acericerus heydeniisame genus7.2%Idiocerus stigmaticalissame family11.5%Parocerus laurifoliaesame family12.7%Tremulicerus vitreussame family12.7%Balcanocerus larvatussame family14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 746 records

Wild obs. + sensor1 701

Museum / vouchered45

Range

Area of Occupancy AOO3 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 842≤1 km 334≤10 km 264>10 km 82

1 522 georeferenced · 179 without coordinates

Open the mapobservation + sensor1 701

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 28≤1 km 11

39 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	8
Philadelphia, US	4
Bavarian State Collection of Zoologylocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Radicondoli, IT	1

5 institutions · 16 of 45 vouchered records shown · 29 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acericerus ribauti

At a glance

Sources6 archives

At a glance

Record type1 746 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Record type1 746 records