Acericerus heydenii

(Kirschbaum, 1868) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Acericerus

At a glance

Occurrence records1 699

Data sources7

Biological traits0

DNA specimens11

eDNA detections17

Sources7 archives

Databases and archives Acericerus heydenii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 699 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 699 records

Environmental DNA3 datasets · 6 countries17 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI≈1.7 Gbp

01Narrative

Acericerus heydenii is een cicade uit de familie van de dwergcicaden. Hij komt voor in bosachtige biotopen, zoals parken en bossen, maar ook op losstaande bomen. Imago's komen het hele jaar voor.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acericerus heydenii has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections17

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

7Gmostly conserved

13Cmostly conserved

22Tmostly conserved

34Tmostly conserved

43Gmostly conserved

46Amostly conserved

49Amostly conserved

74Cmostly conserved

88Amostly conserved

91Amostly conserved

103Tmostly conserved

121Amostly conserved

124Amostly conserved

157Tmostly conserved

175Gmostly conserved

181Amostly conserved

184Amostly conserved

187Cmostly conserved

190Cmostly conserved

199Gmostly conserved

206Cmostly conserved

217Amostly conserved

235Cmostly conserved

253Gmostly conserved

271Amostly conserved

292Amostly conserved

313Amostly conserved

316Gmostly conserved

340Tmostly conserved

346Cmostly conserved

347Cmostly conserved

361Cmostly conserved

430Amostly conserved

448Tmostly conserved

478Amostly conserved

505Cmostly conserved

523Tmostly conserved

529Amostly conserved

568Cmostly conserved

610Cmostly conserved

613Cmostly conserved

616Tmostly conserved

628Amostly conserved

631Amostly conserved

646Cmostly conserved

TACAATGTATTTCATTTTTGGTATTTGATCAGGTATAGTTGGGATAATATTAAGTATAATTATCCGTATAGAACTATCACAACCTGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes3

BINs2

Most divergent pair6.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acericerus ribautisame genus7.2%Tremulicerus vitreussame family12.2%Idiocerus stigmaticalissame family12.3%Idiocerus musteussame family12.7%Parocerus laurifoliaesame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acericerus heydenii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 745 744 753 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acericerus heydenii1.75 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type1 699 records

Wild obs. + sensor1 687

Museum / vouchered12

Range

Area of Occupancy AOO3 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 762≤1 km 391≤10 km 400>10 km 25

1 578 georeferenced · 109 without coordinates

Open the mapobservation + sensor1 687

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 1

11 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
SLU Artdatabankenlocation not on record	3

1 institutions · 3 of 12 vouchered records shown · 9 without an institution code

09Environmental DNA17 detections

Where the DNA of Acericerus heydenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys3

Countries6

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map6 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…UrbanLite sand- og grustak i morenemasse. Tett sk…Bratt ur med edellÃ¸vskog langs kantene og b…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.80 °C 1.20–16.5

Seasonal swing summer↔winter16.0 °C

Max temp (day)11.7 °C 4.10–20.0

Min temp (night)4.60 °C -1.80–12.3

Precipitation63.1 mm/mo 51.3–102

Air humidity63.9 % 58.6–66.5

Moisture balance22.4 mm/mo -51.2–55.2

Vapour deficit411 Pa 233–733

Wind speed3.20 m/s 2.10–4.50

Cloud cover44.8 % 38.7–52.7

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acericerus heydenii

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 699 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 699 records