Aceria tulipae

(Keifer, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Eriophyidae/Aceria

At a glance

Occurrence records42

Data sources7

Biological traits0

DNA specimens14

eDNA detections2

Sources7 archives

Databases and archives Aceria tulipae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD14 specimens

01Narrative

Eriophyes tulipae, commonly known as the dry bulb mite, is a species of mite in the genus Eriophyes. This mite feeds on members of the lily family, and has damaged garlic crops. At one time, it was also thought to feed on wheat and other grasses, but the wheat curl mite is now regarded as a different species, Aceria tosichella.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aceria tulipae has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes2

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P604 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

1Tmostly conserved

2Gmostly conserved

3Cmostly conserved

4Gmostly conserved

5Tvariable

6Amostly conserved

7Tmostly conserved

8Gmostly conserved

9Gmostly conserved

10Amostly conserved

11Amostly conserved

12Cmostly conserved

13Tmostly conserved

14Tmostly conserved

15Amostly conserved

16Gmostly conserved

17Gmostly conserved

19Amostly conserved

20Amostly conserved

21Cmostly conserved

22Cmostly conserved

24Gmostly conserved

25Gmostly conserved

28Cmostly conserved

30Tmostly conserved

33Amostly conserved

34Tmostly conserved

35Tmostly conserved

36Tmostly conserved

38Cmostly conserved

266Gvariable

515Amostly conserved

524Cmostly conserved

533Tmostly conserved

TGCGTATGGAACTTAGGCAACCTGGTTCTTTTATTTACCATGATCATGTTTATAATGTTTTTGTTACTTCTCATGCTTTTATTATAATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BIN1

Most divergent pair0.50%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aceria tosichellasame genus9.0%Neotetra bambusaesame family17.1%Aceria aloinissame genus17.3%Aceria fraxiniflorasame genus17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor5

Museum / vouchered37

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1>10 km 2

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 37 records without

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	23
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	7

2 institutions · 30 of 37 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Aceria tulipae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)