Aceria fraxiniflora

(Felt, 1906) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Eriophyidae/Aceria

At a glance

Occurrence records984

Data sources6

Biological traits0

DNA specimens9

eDNA detections8

Sources6 archives

Databases and archives Aceria fraxiniflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility984 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF984 records

Environmental DNA2 datasets · 2 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Aceria fraxiniflora – gatunek roztocza z nadrodziny szpecieli. Tworzy galasy na jesionach, głównie jesionie pensylwańskim i jesionie amerykańskim.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aceria fraxiniflora has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes3

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACTATATATTTTTTTTTTGGATTTTGGAGGGCTCTTTATGGAACTTCTTTAAGAATAGTAATACGGCTGGAATTAAGGCAACCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aceria pallidasame genus17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S28S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type984 records

Wild obs. + sensor979

Museum / vouchered5

Range

Area of Occupancy AOO2 704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 526≤1 km 123≤10 km 19>10 km 49

717 georeferenced · 262 without coordinates

Open the mapobservation + sensor979

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	3
Cornell University Insect Collectionlocation not on record	2

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Aceria fraxiniflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.0–15.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)20.6 °C 19.5–21.2

Min temp (night)11.8 °C 11.7–12.5

Precipitation84.6 mm/mo 78.2–87.4

Air humidity60.2 % 59.7–60.3

Moisture balance-8.60 mm/mo -30.5–-3.50

Vapour deficit683 Pa 679–727

Wind speed3.70 m/s 3.40–4.40

Cloud cover48.2 % 46.5–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)