Aceria pallida — The Life Data

Animalia/Arthropoda/Arachnida/Trombidiformes/Eriophyidae/Aceria

At a glance

Occurrence records2

Data sources3

Biological traits0

DNA specimens3

eDNA detections0

Sources3 archives

Databases and archives Aceria pallida's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 records

DNA & barcodingBOLD3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aceria pallida has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTTATTTTTGGATTTTGGAGAGCGTTTTATGGTACTTCTTTAAGGATAATTATACGTTTAGAATTGAGTCAACCTGGCTC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type2 records

Wild obs. + sensor2

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.