Acasis viridata

(Packard, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Acasis

At a glance

Occurrence records672

Data sources8

Biological traits0

DNA specimens33

eDNA detections33

Sources8 archives

Databases and archives Acasis viridata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility672 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF672 records

Environmental DNA1 datasets · 2 countries33 detections

DNA & barcodingBOLD33 specimens

01Narrative

Acasis viridata, the olive-and-black carpet, is a species of moth belonging to the family Geometridae. It was described by Packard in 1873. It is found from Newfoundland to British Columbia and the adjacent northern part of the United States, south in the east to Florida, and south in the west to Colorado and Oregon. The wingspan is 18–20 mm. Adults are on wing from April to July in North America. There is one generation per year. The larvae feed on the flower heads of Viburnum cassinoides.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acasis viridata has left across the world's sequence archives.

At a glance

DNA specimens33

BINs2

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

28Gmostly conserved

88Amostly conserved

97Tmostly conserved

169Cvariable

196Gmostly conserved

214Gvariable

217Amostly conserved

265Gmostly conserved

281Amostly conserved

284Cmostly conserved

307Gvariable

322Gmostly conserved

401Tmostly conserved

412Gvariable

514Amostly conserved

578Cvariable

598Cvariable

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATAGTAGGAACTTCTCTTAGATTATTAATTCGAGCAGAGTTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.84%

Haplotypes15

BINs2

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acasis appensatasame genus2.9%Acasis viretatasame genus4.0%Episauris kilianisame family9.7%Euphyia unangulatasame family10.0%Eudulophasia invariasame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type672 records

Wild obs. + sensor593

Museum / vouchered79

Range

Area of Occupancy AOO1 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 400≤1 km 62≤10 km 19>10 km 35

516 georeferenced · 77 without coordinates

Open the mapobservation + sensor593

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 7≤1 km 10≤10 km 8>10 km 2

27 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Edmonton, CA	7
Colorado State Universitylocation not on record	6
New Haven, US	4
Vernal, US	4
East Lansing, US	3
Tartu, EE	2
St. Paul, US	2
Denver, US	1
Mississippi State, US	1
Cambridge, US	1
Cornell University Insect Collectionlocation not on record	1
SOVTlocation not on record	1
Washington, US	1

15 institutions · 56 of 79 vouchered records shown · 23 without an institution code

09Environmental DNA33 detections

Where the DNA of Acasis viridata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

GrasslandForest1. Forest & WoodlandRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 6.70–17.9

Seasonal swing summer↔winter24.1 °C

Max temp (day)16.9 °C 11.7–22.7

Min temp (night)8.50 °C 2.00–13.6

Precipitation102 mm/mo 51.8–157

Air humidity60.3 % 55.9–63.8

Moisture balance-20.7 mm/mo -57.1–29.7

Vapour deficit566 Pa 408–741

Wind speed3.10 m/s 1.40–5.30

Cloud cover45.8 % 30.3–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)