Acasis appensata

(Eversmann, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Acasis

At a glance

Occurrence records704

Data sources8

Biological traits0

DNA specimens29

eDNA detections24

Sources8 archives

Databases and archives Acasis appensata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility704 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF704 records

Environmental DNA1 datasets · 5 countries24 detections

DNA & barcodingBOLD29 specimens

01Narrative

Acasis appensata is a moth of the family Geometridae. It is found in the Palearctic realm. The wingspan is 21–23 mm. The larvae feed on Actaea spicata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acasis appensata has left across the world's sequence archives.

At a glance

DNA specimens29

BINs3

Marker genes1

eDNA detections24

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

25Cvariable

58Gvariable

73Avariable

88Avariable

118Cvariable

169Tvariable

190Gvariable

238Cmostly conserved

280Cvariable

287Tmostly conserved

316Avariable

349Avariable

367Tmostly conserved

386Tvariable

403Gvariable

412Avariable

542Tvariable

559Gvariable

578Tvariable

646Tvariable

AACTTTATATTTTATTTTTGGAATCTGGGCAGGAATAGTAGGAACTTCTCTTAGATTGTTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes8

BINs3

Most divergent pair4.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acasis viridatasame genus2.9%Acasis viretatasame genus4.1%Pelurga comitatasame family9.9%Eudulophasia invariasame family10.2%Euphyia unangulatasame family10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type704 records

Wild obs. + sensor438

Museum / vouchered236

Other30

Origin

Native30

Range

Area of Occupancy AOO964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 117≤1 km 45≤10 km 262>10 km 10

434 georeferenced · 4 without coordinates

Open the mapobservation + sensor438

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 13≤1 km 94≤10 km 83>10 km 5

195 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	54
Tartu, EE	23
University of Tokyo, Department of Zoologylocation not on record	10
ZMAAlocation not on record	9
Zürich, CH	8
Muzeum Górnośląskie w Bytomiulocation not on record	7
Salzburg, AT	6
Helsinki, FI	4
Dhaka, BD	4
Kuopio, FI	3
Metsähallituslocation not on record	3
SLU Artdatabankenlocation not on record	2
Research Collection of Colin Plantlocation not on record	2
Philadelphia, US	2
Naturama Aargaulocation not on record	2
Bern, CH	2
ZSMlocation not on record	1
NHMOlocation not on record	1
Geneva, CH	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Iwate Prefectural Museumlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
KIRMlocation not on record	1
National Institute for Agro-Environmental Scienceslocation not on record	1

25 institutions · 150 of 236 vouchered records shown · 86 without an institution code

09Environmental DNA24 detections

Where the DNA of Acasis appensata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 10.2–18.9

Seasonal swing summer↔winter19.5 °C

Max temp (day)15.5 °C 13.7–23.6

Min temp (night)8.30 °C 4.20–13.2

Precipitation65.2 mm/mo 52.1–174

Air humidity58.0 % 53.3–62.7

Moisture balance-44.1 mm/mo -129–71.2

Vapour deficit613 Pa 457–1,018

Wind speed3.40 m/s 1.90–4.50

Cloud cover38.3 % 33.5–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)