Acanthurus reversus

Randall & Earle, 1999 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Acanthuridae/Acanthurus

At a glance

Occurrence records113

Data sources9

Biological traits6

DNA specimens5

eDNA detections0

Sources9 archives

Databases and archives Acanthurus reversus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

OBISOcean Biodiversity Information System48 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS113 records

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT · NCBI≈1.7 Gbp

01Narrative

Acanthurus reversus is a tropical fish found in coral reefs in the Marquesas Islands.Acanthurus reversus at www.fishbase.org. It was first named by Randall and Earle in 1999.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length34 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max15 m

Depth min4 m

Vulnerability24

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthurus reversus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

94Cmostly conserved

175Gmostly conserved

CACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCCTTAAGCCTCCTGATCCGAGCAGAATTAAGCCAACCAGGCGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthurus tennentiisame genus3.8%Acanthurus auranticavussame genus7.5%Acanthurus leucocheilussame genus8.0%Acanthurus gahhmsame genus8.1%Acanthurus nigricaudasame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthurus reversus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 668 418 491 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthurus reversus1.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type113 records

Wild obs. + sensor21

Museum / vouchered92

Range

Area of Occupancy AOO64 km²

Depth

0–200 m sunlit12

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8 m · max 11 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 11≤1 km 3>10 km 6

20 georeferenced · 1 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 9≤10 km 60

69 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	11
No Voucherlocation not on record	4
Unknownlocation not on record	3
Criobelocation not on record	1
Paris, FR	1

5 institutions · 20 of 92 vouchered records shown · 35 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)