Acanthurus gahhm

(Forsskål, 1775) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Acanthuridae/Acanthurus

At a glance

Occurrence records438

Data sources8

Biological traits7

DNA specimens7

eDNA detections0

Sources8 archives

Databases and archives Acanthurus gahhm's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility295 records↗

OBISOcean Biodiversity Information System143 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS438 records

DNA & barcodingBOLD7 specimens

01Narrative

Acanthurus gahhm is a species of fish in the family Acanthuridae, the surgeonfishes. Its common name is black surgeonfish. It is endemic to the western Indian Ocean, where it occurs in the Red Sea, the Gulf of Aden and Socotra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length40 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max50 m

Depth min5 m

Vulnerability30

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthurus gahhm has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

257Tmostly conserved

272Cmostly conserved

309Gmostly conserved

313Cmostly conserved

473Tmostly conserved

GCACCCTTTATTTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTGAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes4

BIN1

Most divergent pair0.46%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthurus matasame genus5.4%Acanthurus albimentosame genus6.1%Acanthurus blochiisame genus6.2%Acanthurus barienesame genus6.8%Acanthurus dussumierisame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type438 records

Wild obs. + sensor199

Museum / vouchered236

Other3

Origin

Native7

Range

Area of Occupancy AOO816 km²

Depth

0–200 m sunlit42

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.3 m · max 18 m · 42 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 36≤1 km 52≤10 km 14>10 km 16

118 georeferenced · 81 without coordinates

Open the mapobservation + sensor199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 7≤1 km 6≤10 km 20>10 km 14

47 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	43
Washington, US	13
Chicago, US	9
Paris, FR	7
UWFClocation not on record	4
	4
Los Angeles, US	3
South Kensington, GB	3
Cambridge, US	2
New Haven, US	2
Frankfurt am Main	2
FishBaselocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Stockholm, SE	1
SEAOBISlocation not on record	1
Helsinki, FI	1
University of California San Diegolocation not on record	1
Ann Arbor, US	1
South African Institute for Aquatic Biodiversitylocation not on record	1

19 institutions · 100 of 236 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)