Acanthurus leucopareius

(Jenkins, 1903) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Acanthuridae/Acanthurus

At a glance

Occurrence records8 837

Data sources11

Biological traits7

DNA specimens10

eDNA detections10

Sources11 archives

Databases and archives Acanthurus leucopareius's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 695 records↗

OBISOcean Biodiversity Information System4 142 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS8 837 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT · NCBI≈642 Mbp

01Narrative

Acanthurus leucopareius is a sub-tropical fish known commonly as the whitebar surgeonfish or the head-band surgeonfish.Common names for Acanthurus leucopareius at www.fishbase.org. It is somewhat commercial in fisheries and is used in aquariums.Acanthurus leucopareius at www.fishbase.org. It was first named by Jenkins in 1903.Page 39, Surgeonfishes of the world, Volume 4 of Bishop Museum bulletin in zoology. By John E. Randall; published by Mutual Pub., 2001. /

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length25 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max85 m

Depth min1 m

Vulnerability15

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthurus leucopareius has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

43Avariable

47Cvariable

58Avariable

97Gvariable

211Tvariable

340Avariable

349Cvariable

367Avariable

460Cmostly conserved

541Gmostly conserved

580Tmostly conserved

622Gvariable

CCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGTACAGCTCTAAGCCTCCTAATCCGGGCAGAATTAAGCCAACCTGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.81%

Haplotypes6

BIN1

Most divergent pair1.4%

N.AmericaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthurus nigrorissame genus6.1%Acanthurus nigrofuscussame genus8.5%Acanthurus nigricaudasame genus10.7%Acanthurus guttatussame genus10.8%Acanthurus leucocheilussame genus11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthurus leucopareius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈642 241 911 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthurus leucopareius0.64 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type8 837 records

Wild obs. + sensor8 674

Museum / vouchered159

Other4

Origin

Native1

Range

Area of Occupancy AOO3 384 km²

Depth

0–200 m sunlit4 070

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8.1 m · max 29 m · 4 070 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 6 565≤1 km 1 936≤10 km 57>10 km 36

8 594 georeferenced · 80 without coordinates

Open the mapobservation + sensor8 674

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 11≤1 km 20≤10 km 18>10 km 2

51 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	34
Auckland, NZ	7
Vancouver, CA	6
Universidad Católica del Nortelocation not on record	6
CASlocation not on record	5
Kagoshima University Museumlocation not on record	5
Paris, FR	4
FishBaselocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
South African Institute for Aquatic Biodiversitylocation not on record	2
SEAOBISlocation not on record	1
Fisheries Research Laboratory, Mie Universitylocation not on record	1
Cambridge, US	1
Honolulu, US	1
	1
Toronto, CA	1
Los Angeles, US	1
Chicago, US	1

18 institutions · 82 of 159 vouchered records shown · 5 without an institution code

09Environmental DNA10 detections

Where the DNA of Acanthurus leucopareius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 22.2–24.6

Seasonal swing summer↔winter4.00 °C

Max temp (day)25.0 °C 23.0–25.2

Min temp (night)22.4 °C 21.7–23.9

Precipitation152 mm/mo 50.7–168

Air humidity60.7 % 59.7–61.4

Vapour deficit1,166 Pa 1,052–1,188

Cloud cover30.7 % 18.5–33.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthurus leucopareius

At a glance

Sources11 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type8 837 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 837 records