Acanthurus guttatus

Forster, 1801 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Acanthuridae/Acanthurus

At a glance

Occurrence records2 643

Data sources8

Biological traits0

DNA specimens19

eDNA detections19

Sources8 archives

Databases and archives Acanthurus guttatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 596 records↗

OBISOcean Biodiversity Information System1 047 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS2 643 records

Environmental DNA1 datasets · 7 countries19 detections

DNA & barcodingBOLD19 specimens

01Narrative

Le Chirurgien-pintade est une espèce de poissons marins appartenant à la famille des Acanthuridae. Il est également appelé chirurgien moucheté ou chirurgien pointillé. L'espèce mesure jusqu'à 26 cm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthurus guttatus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections19

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

145Gmostly conserved

208Gmostly conserved

463Avariable

646Amostly conserved

CCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACGGCTCTAAGCCTCCTAATCCGGGCAGAATTAAGCCAACCAGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthurus coeruleussame genus7.2%Acanthurus tennentiisame genus7.5%Acanthurus leucocheilussame genus7.5%Acanthurus nigricaudasame genus7.8%Acanthurus nigricanssame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 643 records

Wild obs. + sensor2 297

Museum / vouchered341

Other5

Origin

Native11

Range

Area of Occupancy AOO2 828 km²

Depth

0–200 m sunlit696

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 152.5 m · 696 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 577≤1 km 242≤10 km 79>10 km 27

1 925 georeferenced · 372 without coordinates

Open the mapobservation + sensor2 297

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 17≤1 km 28≤10 km 30>10 km 21

96 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence341

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	54
CASlocation not on record	21
Sydney, AU	13
Paris, FR	8
Chicago, US	8
Cambridge, US	7
Los Angeles, US	7
UWFClocation not on record	4
Toronto, CA	4
Wuzhou, CN	3
FishBaselocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Fisheries Research Laboratory, Mie Universitylocation not on record	1
Stockholm, SE	1
Smithsonianlocation not on record	1
No Voucherlocation not on record	1
University of Alberta Museumslocation not on record	1
	1
Kagoshima University Museumlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Muséum National d'Histoire Naturellelocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1
Western Australian Museumlocation not on record	1

23 institutions · 143 of 341 vouchered records shown · 10 without an institution code

09Environmental DNA19 detections

Where the DNA of Acanthurus guttatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 23.7–26.7

Seasonal swing summer↔winter4.10 °C

Max temp (day)26.3 °C 24.6–27.4

Min temp (night)23.6 °C 21.8–25.9

Precipitation124 mm/mo 57.6–274

Air humidity61.2 % 56.6–66.5

Vapour deficit1,276 Pa 888–1,328

Cloud cover24.8 % 15.2–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthurus guttatus

At a glance

Sources8 archives

At a glance

Record type2 643 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 643 records