Acanthurus grammoptilus

Richardson, 1843 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Acanthuridae/Acanthurus

At a glance

Occurrence records4 392

Data sources9

Biological traits8

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Acanthurus grammoptilus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 538 records↗

OBISOcean Biodiversity Information System1 854 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS4 392 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceNCBI≈584 Mbp

01Narrative

Acanthurus grammoptilus is a tropical fish which is found in the Philippines, Indonesia and Australia.Acanthurus grammoptilus at www.fishbase.org. Also known, commonly, as the finelined-surgeonfish, it is used commercially in fisheries, and can be used for food.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length35.6 cm

Body mass1 197 g

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max91 m

Depth min22 m

Vulnerability29.52

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthurus grammoptilus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P669 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.52%

Haplotypes2

BIN1

Most divergent pair0.90%

Where individuals differ — all 7 variable positions, in barcode order

144Amostly conserved

171Gmostly conserved

189Gmostly conserved

249Amostly conserved

369Gmostly conserved

510Tmostly conserved

642Tmostly conserved

ATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGAACAGCCCTAAGTCTTCTAATCCGAGCAGAACTAAGCCAACCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthurus blochiisame genus7.8%Acanthurus leucocheilussame genus8.0%Acanthurus gahhmsame genus8.7%Acanthurus matasame genus8.8%Acanthurus xanthopterussame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Acanthurus grammoptilus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈583 990 304 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthurus grammoptilus0.58 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type4 392 records

Wild obs. + sensor4 054

Museum / vouchered316

Cultivated / captive6

Other16

Range

Area of Occupancy AOO3 476 km²

Depth

0–200 m sunlit1 496

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 131 m · 1 496 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 2 274≤1 km 749≤10 km 7>10 km 10

3 040 georeferenced · 1 014 without coordinates

Open the mapobservation + sensor4 054

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 15≤1 km 71≤10 km 28>10 km 49

163 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence316

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	33
Museum and Art Gallery of the Northern Territorylocation not on record	27
Sydney, AU	22
Australian National Fish Collectionlocation not on record	18
Natick, US	6
DEWlocation not on record	5
	4
Museums Victorialocation not on record	2
Washington, US	2
Toronto, CA	1
South Kensington, GB	1
Chicago, US	1

12 institutions · 122 of 316 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Acanthurus grammoptilus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 24.4–26.5

Seasonal swing summer↔winter5.90 °C

Max temp (day)25.9 °C 25.2–27.4

Min temp (night)24.5 °C 23.6–25.6

Precipitation0.4 mm/mo 0.3–174

Air humidity62.5 % 61.4–64.4

Vapour deficit1,201 Pa 1,179–1,236

Cloud cover16.9 % 13.9–36.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthurus grammoptilus

At a glance

Sources9 archives

Size & morphology2

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 392 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 392 records