Acanthonyx lunulatus

(Risso, 1816) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Epialtidae/Acanthonyx

At a glance

Occurrence records1 076

Data sources8

Biological traits4

DNA specimens147

eDNA detections147

Sources8 archives

Databases and archives Acanthonyx lunulatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility811 records↗

OBISOcean Biodiversity Information System265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI147 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics147 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 076 records

Environmental DNA1 datasets · 9 countries147 detections

DNA & barcodingBOLD147 specimens

01Narrative

Acanthonyx lunulatus is een krabbensoort uit de familie van de Epialtidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1816 door Risso.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max20 m

Depth min0 m

05DNA & barcoding147 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthonyx lunulatus has left across the world's sequence archives.

At a glance

DNA specimens147

BINs1

Marker genes2

eDNA detections147

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus146 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

27Gmostly conserved

33Gvariable

36Gvariable

48Tvariable

135Amostly conserved

162Gvariable

165Amostly conserved

192Tmostly conserved

210Amostly conserved

270Amostly conserved

276Amostly conserved

309Avariable

372Tmostly conserved

390Cmostly conserved

507Avariable

546Amostly conserved

576Amostly conserved

579Gmostly conserved

TCCTTAAGATTAATTATTCGAGCTGAGCTTGGGCAGCCAGGCACTCTTATTGGTAATGATCAAATTTATAATGTCGCCGTAACAGCCCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 43 variants.

Diversity (π)1.1%

Haplotypes43

BIN1

Most divergent pair2.9%

EuropeAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthonyx brevifronssame genus6.7%Pugettia foliatasame family15.0%Acanthonyx petiveriisame genus15.1%Pugettia gracilissame family15.5%Cataleptodius floridanussame order15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 076 records

Wild obs. + sensor469

Museum / vouchered566

Other41

Origin

Native75

Range

Area of Occupancy AOO1 488 km²

Depth

0–200 m sunlit22

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.2 m · max 43.5 m · 22 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 117≤1 km 156≤10 km 66

339 georeferenced · 130 without coordinates

Open the mapobservation + sensor469

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤1 km 13≤10 km 6>10 km 3

22 georeferenced · 544 without coordinates

Open the institutions mapphysical evidence566

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICM-CSIClocation not on record	118
AUTHlocation not on record	41
Washington, US	26
Paris, FR	17
Stockholm, SE	12
Universidade de Lisboa, Museu Bocagelocation not on record	8
Museu Nacional de História Natural e da Ciêncialocation not on record	8
Frankfurt am Main	5
Cambridge, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Tromsø, NO	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
IPMAlocation not on record	2
NTNU-VMlocation not on record	1
Zoologisches Museum Hamburglocation not on record	1
Helsinki, FI	1
Natural History Museum Rotterdamlocation not on record	1
Turkmen Agricultural University named after S.A. Niyazovlocation not on record	1
University of Oslo (UiO)location not on record	1
	1
MZLUlocation not on record	1

21 institutions · 257 of 566 vouchered records shown · 143 without an institution code

09Environmental DNA147 detections

Where the DNA of Acanthonyx lunulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found147

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 147 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 16.9–18.6

Seasonal swing summer↔winter12.7 °C

Max temp (day)20.1 °C 18.8–21.9

Min temp (night)15.7 °C 12.8–17.6

Precipitation39.7 mm/mo 26.9–72.2

Air humidity60.9 % 58.4–63.7

Vapour deficit832 Pa 746–898

Cloud cover35.2 % 28.6–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 146 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthonyx lunulatus

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type1 076 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 076 records