Acanthonyx petiverii

H.Milne Edwards, 1834 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Epialtidae/Acanthonyx

At a glance

Occurrence records457

Data sources7

Biological traits4

DNA specimens52

eDNA detections44

Sources7 archives

Databases and archives Acanthonyx petiverii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility366 records↗

OBISOcean Biodiversity Information System91 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS457 records

Environmental DNA1 datasets · 4 countries44 detections

DNA & barcodingBOLD52 specimens

01Narrative

Acanthonyx petiverii is een krabbensoort uit de familie van de Epialtidae. De wetenschappelijke naam van de soort werd in 1834 voor het eerst geldig gepubliceerd door Henri Milne-Edwards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max29 m

Depth min0 m

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthonyx petiverii has left across the world's sequence archives.

At a glance

DNA specimens52

BINs2

Marker genes2

eDNA detections44

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P637 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

31Tmostly conserved

37Cmostly conserved

39Amostly conserved

138Tmostly conserved

147Gmostly conserved

171Amostly conserved

186Cmostly conserved

193Cmostly conserved

201Tmostly conserved

210Amostly conserved

213Tmostly conserved

240Tmostly conserved

255Amostly conserved

258Cmostly conserved

318Tmostly conserved

324Tmostly conserved

333Gmostly conserved

342Tmostly conserved

345Cmostly conserved

351Cmostly conserved

387Tmostly conserved

402Cmostly conserved

409Cmostly conserved

411Tmostly conserved

414Amostly conserved

417Gmostly conserved

420Tmostly conserved

423Tmostly conserved

444Tmostly conserved

481Tmostly conserved

510Cmostly conserved

522Tmostly conserved

537Amostly conserved

561Cmostly conserved

GGAGCTTGAGCAGGAATAGTTGGAACATCATTAAGACTAATTATCCGAGCTGAACTTGGTCAACCAGGAACTCTTATTGGTAATGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes18

BINs2

Most divergent pair6.9%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Taliepus dentatussame family11.8%Acantholobulus pacificussame order11.8%Daldorfia leprosasame order12.2%Lybia edmondsonisame order12.6%Lybia tessellatasame order12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type457 records

Wild obs. + sensor38

Museum / vouchered419

Origin

Native3

Range

Area of Occupancy AOO1 072 km²

Depth

0–200 m sunlit42

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9.1 m · max 50 m · 42 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 1≤10 km 2>10 km 8

14 georeferenced · 24 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 144≤1 km 5≤10 km 25>10 km 1

175 georeferenced · 244 without coordinates

Open the institutions mapphysical evidence419

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	76
Los Angeles, US	44
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	41
Mexico City, MX	39
San Nicolás de los Garza, MX	23
Museu de Zoologia da Universidade de Sao Paulolocation not on record	21
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	11
	9
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	8
Paris, FR	8
Cambridge, US	7
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	5
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	4
Texas Cooperative Wildlife Collectionlocation not on record	3
Stockholm, SE	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Universidad del Marlocation not on record	1
Universidad del Valle (UniValle)location not on record	1
Puerto Ayora, EC	1
Toronto, CA	1
Masindi, UG	1
CASlocation not on record	1
UM-RSMASlocation not on record	1

23 institutions · 311 of 419 vouchered records shown · 34 without an institution code

09Environmental DNA44 detections

Where the DNA of Acanthonyx petiverii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 23.0–26.3

Seasonal swing summer↔winter3.10 °C

Max temp (day)27.6 °C 25.6–31.4

Min temp (night)24.4 °C 19.5–25.2

Precipitation107 mm/mo 3.10–292

Air humidity63.5 % 52.4–67.8

Vapour deficit1,241 Pa 886–1,488

Cloud cover32.4 % 19.6–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)