Acanthocinus pusillus

(Kirby, 1837) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Acanthocinus

At a glance

Occurrence records78

Data sources7

Biological traits0

DNA specimens26

eDNA detections21

Sources7 archives

Databases and archives Acanthocinus pusillus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD26 specimens

01Narrative

Acanthocinus pusillus is a species of longhorn beetles of the subfamily Lamiinae. It was described by William Kirby in 1837.Acanthocinus pusillus at ITIS.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocinus pusillus has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes1

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Diversity (π)3.2%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 82 variable positions, in barcode order

25Cmostly conserved

31Amostly conserved

34Tmostly conserved

46Amostly conserved

49Amostly conserved

50Cmostly conserved

58Amostly conserved

59Cmostly conserved

67Tmostly conserved

74Tmostly conserved

76Amostly conserved

85Tmostly conserved

100Cmostly conserved

133Amostly conserved

145Cmostly conserved

163Tmostly conserved

172Tmostly conserved

178Cmostly conserved

184Gmostly conserved

202Cmostly conserved

205Amostly conserved

206Tmostly conserved

208Amostly conserved

211Gmostly conserved

214Gmostly conserved

217Gmostly conserved

226Cmostly conserved

238Cmostly conserved

250Tmostly conserved

271Cmostly conserved

274Amostly conserved

278Cmostly conserved

304Tmostly conserved

307Amostly conserved

319Amostly conserved

322Tmostly conserved

337Amostly conserved

340Cmostly conserved

364Amostly conserved

370Amostly conserved

373Amostly conserved

379Amostly conserved

386Cmostly conserved

388Cmostly conserved

391Amostly conserved

401Tmostly conserved

403Amostly conserved

406Tmostly conserved

412Amostly conserved

415Amostly conserved

416Amostly conserved

430Gmostly conserved

433Amostly conserved

436Tmostly conserved

439Tmostly conserved

448Cmostly conserved

451Tmostly conserved

466Amostly conserved

469Amostly conserved

475Tmostly conserved

478Amostly conserved

493Tmostly conserved

499Tmostly conserved

508Amostly conserved

514Amostly conserved

526Tmostly conserved

529Tmostly conserved

533Cmostly conserved

535Tmostly conserved

538Tmostly conserved

542Tmostly conserved

547Amostly conserved

553Cmostly conserved

568Cmostly conserved

578Cmostly conserved

589Cmostly conserved

616Cmostly conserved

628Gmostly conserved

631Tmostly conserved

637Cmostly conserved

649Gmostly conserved

652Cmostly conserved

AACTTTATATTTTATTTTTGGAGCCTGATCAGGTATAGTTGGAACATCACTAAGAATACTAATTCGTTCAGAATTAGGAAATCCTGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthocinus griseussame genus11.1%Acanthocinus reticulatussame genus12.0%Acanthocinus obsoletussame genus12.0%Acanthocinus obliquussame genus12.3%Eutrichillus biguttatussame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor50

Museum / vouchered28

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 25≤1 km 11≤10 km 3>10 km 3

42 georeferenced · 8 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Royal Saskatchewan Museumlocation not on record	15
University of Alberta Museums (UAM)location not on record	5
University of Guelphlocation not on record	3
Edmonton, CA	2
Lake Placid, US	1
Centre for Biodiversity Genomicslocation not on record	1
East Lansing, US	1

7 institutions · 28 of 28 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Acanthocinus pusillus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 10.5–18.0

Seasonal swing summer↔winter27.5 °C

Max temp (day)21.5 °C 14.4–23.5

Min temp (night)11.8 °C 6.90–13.5

Precipitation110 mm/mo 84.6–155

Air humidity58.7 % 57.3–64.1

Moisture balance-7.00 mm/mo -58.0–98.9

Vapour deficit744 Pa 490–883

Wind speed3.10 m/s 2.00–3.40

Cloud cover44.8 % 41.5–54.4

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)