Acanthocinus obliquus

(LeConte, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Acanthocinus

At a glance

Occurrence records104

Data sources7

Biological traits0

DNA specimens10

eDNA detections9

Sources7 archives

Databases and archives Acanthocinus obliquus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF104 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Acanthocinus obliquus is a species of longhorn beetle of the subfamily Lamiinae. It was described by John Lawrence LeConte in 1862.Acanthocinus obliquus at ITIS.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocinus obliquus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 55 variable positions, in barcode order

7Amostly conserved

22Tmostly conserved

37Amostly conserved

64Tmostly conserved

85Amostly conserved

112Cmostly conserved

118Tmostly conserved

133Cmostly conserved

139Tmostly conserved

178Cmostly conserved

181Amostly conserved

190Amostly conserved

196Gmostly conserved

199Amostly conserved

202Cmostly conserved

212Cmostly conserved

220Tmostly conserved

235Cmostly conserved

259Tmostly conserved

265Amostly conserved

268Amostly conserved

271Tmostly conserved

277Amostly conserved

316Cmostly conserved

318Cmostly conserved

322Amostly conserved

328Amostly conserved

337Tmostly conserved

340Cmostly conserved

343Cmostly conserved

352Gmostly conserved

364Tmostly conserved

370Tmostly conserved

376Tmostly conserved

388Gmostly conserved

403Cmostly conserved

421Gmostly conserved

469Amostly conserved

487Tmostly conserved

490Cmostly conserved

496Gmostly conserved

508Tmostly conserved

547Tmostly conserved

553Amostly conserved

568Amostly conserved

574Tmostly conserved

578Tmostly conserved

581Cmostly conserved

595Tmostly conserved

619Gmostly conserved

622Gmostly conserved

628Amostly conserved

631Gmostly conserved

634Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGTGCATGATCAGGAATAGTTGGAACTTCACTAAGTATACTAATTCGTTCAGAATTAGGAAACCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes6

BINs2

Most divergent pair8.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthocinus aedilissame genus12.0%Phloiotrya rufipessame order14.1%Nephogenes didymospilasame order15.2%Heliconius melpomenesame order15.4%Hemiscopis suffusalissame order15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type104 records

Wild obs. + sensor58

Museum / vouchered46

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 33≤1 km 15≤10 km 2>10 km 2

52 georeferenced · 6 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 4

5 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	19
Santa Barbara Museum of Natural Historylocation not on record	11
University of Alberta Museums (UAM)location not on record	8
San Diego, US	2
Essig Museum of Entomologylocation not on record	2
Albuquerque, US	1
Provo, US	1
WIlocation not on record	1
University of Alabamalocation not on record	1

9 institutions · 46 of 46 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Acanthocinus obliquus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 10.4–22.6

Seasonal swing summer↔winter22.3 °C

Max temp (day)24.4 °C 15.9–28.8

Min temp (night)13.7 °C 5.40–16.5

Precipitation34.3 mm/mo 23.7–63.8

Air humidity50.9 % 48.3–54.6

Moisture balance-98.2 mm/mo -138–-22.4

Vapour deficit1,073 Pa 589–1,449

Wind speed2.50 m/s 1.80–3.20

Cloud cover36.5 % 34.3–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)