Acanthochitona viridis

(Pease, 1872) · species

image placeholder — illustration coming later

Animalia/Mollusca/Polyplacophora/Chitonida/Acanthochitonidae/Acanthochitona

At a glance

Occurrence records62

Data sources7

Biological traits2

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Acanthochitona viridis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

OBISOcean Biodiversity Information System20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS62 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Acanthochitona viridis is een keverslakkensoort uit de familie van de Acanthochitonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1872 door Pease.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthochitona viridis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes2

BINs2

Most divergent pair2.6%

Where individuals differ — all 22 variable positions, in barcode order

106Tvariable

169Avariable

196Avariable

217Gvariable

310Gvariable

313Tvariable

337Tvariable

349Avariable

352Cvariable

397Tvariable

406Tvariable

433Avariable

466Gvariable

475Cvariable

514Avariable

539Tvariable

583Avariable

592Tvariable

622Tvariable

634Cvariable

652Cvariable

655Avariable

TACTTTATATATTTTGTTTGGAATTTGATCTGGTTTGGTTGGGACGGCTTTAAGGTTGTTGATTCGAGCAGAATTAGGTCAGCCTGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthochitona achatessame genus8.7%Acanthochitona defilippiisame genus9.8%Acanthochitona rubrolineatasame genus10.7%Acanthochitona hirudiniformissame genus12.9%Acanthochitona fascicularissame genus13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor14

Museum / vouchered48

Range

Area of Occupancy AOO148 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 12.5 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 7≤1 km 1>10 km 1

9 georeferenced · 5 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤1 km 17≤10 km 10>10 km 5

32 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	14
Santa Barbara Museum of Natural Historylocation not on record	3
Delaware Museum of Nature and Sciencelocation not on record	3
Philadelphia, US	2
Cambridge, US	1
Denver, US	1
Provincia di Livornolocation not on record	1

7 institutions · 25 of 48 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Acanthochitona viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 24.5–24.5

Seasonal swing summer↔winter3.10 °C

Max temp (day)25.2 °C

Min temp (night)23.8 °C

Precipitation125 mm/mo

Air humidity61.9 %

Moisture balance-0.1 mm/mo

Vapour deficit1,162 Pa

Wind speed3.70 m/s

Cloud cover36.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)