Acanthochitona defilippii

(Tapparone Canefri, 1874) · species

image placeholder — illustration coming later

Animalia/Mollusca/Polyplacophora/Chitonida/Acanthochitonidae/Acanthochitona

At a glance

Occurrence records1 035

Data sources9

Biological traits0

DNA specimens84

eDNA detections245

Sources9 archives

Databases and archives Acanthochitona defilippii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility600 records↗

OBISOcean Biodiversity Information System435 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI245 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics84 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF · OBIS1 035 records

Environmental DNA3 datasets · 2 countries245 detections

DNA & barcodingBOLD84 specimens

01Narrative

Acanthochitona defilippii is een keverslakkensoort uit de familie van de Acanthochitonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Tapparone Canefri.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition8 compounds

Compounds documented for Acanthochitona defilippii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Carotenoids (C40, β-β)7

Carotenoids (C40, β-ε)1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
beta-Carotene	present	LOTUS
Canthaxanthin	present	LOTUS
Echinenone	present	LOTUS
Fritschiellaxanthin/(3S,3'R,6'R)-4-Ketolutein	present	LOTUS
Fucoxanthin	present	LOTUS
Fucoxanthinol	present	LOTUS
Isocryptoxanthin	present	LOTUS
Isozeaxanthin	present	LOTUS

05DNA & barcoding84 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthochitona defilippii has left across the world's sequence archives.

At a glance

DNA specimens84

BINs3

Marker genes2

eDNA detections245

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P510 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

7Tmostly conserved

16Avariable

76Amostly conserved

79Amostly conserved

97Cvariable

133Gvariable

136Tvariable

148Avariable

157Amostly conserved

166Gvariable

167Cvariable

169Gmostly conserved

175Tmostly conserved

205Gvariable

208Avariable

214Amostly conserved

217Amostly conserved

226Avariable

229Avariable

232Gvariable

235Gvariable

250Cvariable

253Gvariable

256Tmostly conserved

277Gvariable

280Avariable

287Gmostly conserved

298Tmostly conserved

310Cvariable

313Amostly conserved

328Amostly conserved

361Gmostly conserved

364Amostly conserved

378Gmostly conserved

382Gvariable

391Gvariable

394Avariable

403Cvariable

415Amostly conserved

424Amostly conserved

436Tvariable

443Cvariable

457Tmostly conserved

469Gmostly conserved

499Cmostly conserved

508Amostly conserved

AGGTGATGATCAGTTATATAATGTAATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTTTGGTTATACCAATAATAATTGGGGGTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes30

BINs3

Most divergent pair9.8%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthochitona rubrolineatasame genus7.5%Acanthochitona achatessame genus9.6%Acanthochitona viridissame genus9.8%Acanthochitona hirudiniformissame genus12.9%Acanthochitona pilosasame genus13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_087903 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6ND5ND4ND4LCYTBND6ND1COX3ND3ND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 035 records

Wild obs. + sensor289

Museum / vouchered746

Range

Area of Occupancy AOO512 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 11.4 m · max 20.3 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 181≤1 km 39≤10 km 1>10 km 3

224 georeferenced · 65 without coordinates

Open the mapobservation + sensor289

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 7≤10 km 4>10 km 29

41 georeferenced · 705 without coordinates

Open the institutions mapphysical evidence746

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	276
NSMKlocation not on record	85
Toyohashi Museum Of Natural Historylocation not on record	24
National Institute of Biological Resourceslocation not on record	9
Brussels, BE	8
Philadelphia, US	6
CASlocation not on record	6
RBINS-Scientific Heritagelocation not on record	5
Natural History Museum Rotterdamlocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	3
BIKlocation not on record	2
Gifu prefectural Museumlocation not on record	2
ENHMlocation not on record	2
Gothenburg, SE	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Denver, US	1
Stockholm, SE	1
Wakayama Prefectural Museum of Natural Historylocation not on record	1

18 institutions · 437 of 746 vouchered records shown · 11 without an institution code

09Environmental DNA245 detections

Where the DNA of Acanthochitona defilippii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found245

Studies independent surveys3

Countries2

Verifiable raw sequence linked152

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 245 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C -5.30–19.1

Seasonal swing summer↔winter22.7 °C

Max temp (day)12.2 °C -1.40–23.2

Min temp (night)6.60 °C -8.90–16.4

Precipitation107 mm/mo 89.3–136

Air humidity60.9 % 59.7–65.7

Moisture balance52.2 mm/mo -44.0–91.8

Vapour deficit447 Pa 165–824

Wind speed5.10 m/s 3.90–6.00

Cloud cover51.9 % 45.7–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 158 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthochitona defilippii

At a glance

Sources9 archives

Compound class profile2 classes

Documented compounds8 total

At a glance

Record type1 035 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 035 records