Acanthochitona lineata

Lyons, 1988 · species

image placeholder — illustration coming later

Animalia/Mollusca/Polyplacophora/Chitonida/Acanthochitonidae/Acanthochitona

At a glance

Occurrence records39

Data sources6

Biological traits4

DNA specimens6

eDNA detections2

Sources6 archives

Databases and archives Acanthochitona lineata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

OBISOcean Biodiversity Information System16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS39 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD6 specimens

01Narrative

Acanthochitona lineata is een keverslakkensoort uit de familie van de Acanthochitonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1988 door Lyons.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max20 m

Depth min0 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthochitona lineata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.9%

Haplotypes2

BINs2

Most divergent pair1.1%

Where individuals differ — all 25 variable positions, in barcode order

94Gvariable

95Tvariable

106Cmostly conserved

127Tmostly conserved

133Tvariable

136Cmostly conserved

190Gvariable

193Cvariable

197Tvariable

206Cvariable

208Gvariable

214Amostly conserved

226Cvariable

229Gvariable

284Cvariable

319Tmostly conserved

322Tvariable

358Tmostly conserved

397Tvariable

412Tvariable

418Tmostly conserved

436Cvariable

517Gvariable

547Gvariable

649Avariable

AACTTTATATATTTTGTTTGGTATTTGGTCAGGTTTAGTTGGGACTGCTTTAAGTTTATTGATTCGGGCGGAGCTAGGACAACCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthochitona hirudiniformissame genus11.0%Acanthochitona ferreiraisame genus13.4%Acanthochitona crinitasame genus13.5%Acanthochitona pilosasame genus14.0%Acanthochitona discrepanssame genus14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type39 records

Wild obs. + sensor9

Museum / vouchered30

Range

Area of Occupancy AOO76 km²

Depth

0–200 m sunlit10

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8.5 m · max 10 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2>10 km 3

5 georeferenced · 4 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	3
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	2
Brussels, BE	2
Denver, US	1
RBINS-Scientific Heritagelocation not on record	1
Washington, US	1

6 institutions · 10 of 30 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Acanthochitona lineata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.3–26.3

Seasonal swing summer↔winter2.60 °C

Max temp (day)27.4 °C 26.8–28.0

Min temp (night)24.4 °C 23.9–24.8

Precipitation75.7 mm/mo 46.0–105

Air humidity60.8 % 59.7–62.0

Vapour deficit1,298 Pa 1,294–1,302

Cloud cover24.0 % 22.2–25.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)