Acanthochitona discrepans

(T.Brown, 1827) · species

image placeholder — illustration coming later

Animalia/Mollusca/Polyplacophora/Chitonida/Acanthochitonidae/Acanthochitona

At a glance

Occurrence records136

Data sources7

Biological traits2

DNA specimens34

eDNA detections0

Sources7 archives

Databases and archives Acanthochitona discrepans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 records↗

OBISOcean Biodiversity Information System26 records↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS136 records

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

Acanthochitona discrepans is een keverslakkensoort uit de familie van de Acanthochitonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1827 door Brown.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthochitona discrepans has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

316Amostly conserved

373Cvariable

403Tmostly conserved

454Gmostly conserved

496Gmostly conserved

TACTTTATATATTTTGTTTGGAATTTGATCTGGTTTGGTTGGGACGGCTTTGAGTCTATTAATTCGAGCTGAGCTAGGGCAACCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes7

BIN1

Most divergent pair0.65%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthochitona pilosasame genus6.8%Acanthochitona crinitasame genus9.9%Acanthochitona ferreiraisame genus13.1%Acanthochitona fascicularissame genus13.3%Acanthochitona hirudiniformissame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthochitona discrepans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 172 942 069 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthochitona discrepans1.17 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type136 records

Wild obs. + sensor37

Museum / vouchered83

Other16

Range

Area of Occupancy AOO264 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 17.5 m · max 38 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 18≤10 km 5

23 georeferenced · 14 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 3≤1 km 7≤10 km 5>10 km 17

32 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	11
Brussels, BE	9
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	8
Cantablocation not on record	7
Stockholm, SE	7
Cambridge, US	6
RBINS-Scientific Heritagelocation not on record	4
Salzburg, AT	1
Denver, US	1
Station Biologique de Roscoff (EDMO:521)location not on record	1
Barcelona, ES	1
Philadelphia, US	1
Santa Barbara Museum of Natural Historylocation not on record	1
Laboratoria di biologia marina di Triestelocation not on record	1
Champaign, US	1
South Kensington, GB	1

16 institutions · 61 of 83 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)