Acanthochitona hemphilli

(Pilsbry, 1893) · species

image placeholder — illustration coming later

Animalia/Mollusca/Polyplacophora/Chitonida/Acanthochitonidae/Acanthochitona

At a glance

Occurrence records262

Data sources7

Biological traits6

DNA specimens9

eDNA detections5

Sources7 archives

Databases and archives Acanthochitona hemphilli's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility147 records↗

OBISOcean Biodiversity Information System115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS262 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acanthochitona hemphilli is een keverslakkensoort uit de familie van de Acanthochitonidae. De wetenschappelijke naam van de soort werd in 1893 voor het eerst geldig gepubliceerd door Henry Augustus Pilsbry.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.54 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max18 m

Depth min0 m

Vulnerability10

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthochitona hemphilli has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P590 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

12Amostly conserved

21Cvariable

36Avariable

60Avariable

66Tvariable

75Gvariable

78Amostly conserved

81Cvariable

87Gvariable

114Gvariable

159Cvariable

171Avariable

174Gvariable

186Gvariable

250Tmostly conserved

279Tmostly conserved

303Gvariable

339Tvariable

384Avariable

396Avariable

423Tmostly conserved

435Gmostly conserved

438Avariable

441Tvariable

456Gvariable

459Avariable

462Amostly conserved

477Gmostly conserved

486Gvariable

498Gvariable

507Avariable

508Cvariable

516Amostly conserved

522Gvariable

525Amostly conserved

531Avariable

543Avariable

546Gmostly conserved

561Tvariable

567Cmostly conserved

570Cmostly conserved

588Tvariable

TTGGTTGGAACAGCTTTAAGCTTGCTTATTCGAGCAGAGTTAGGTCAGCCTGGTGCTTTATTGGGTGATGATCAGTTATACAATGTGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes6

BINs3

Most divergent pair5.6%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthochitona ferreiraisame genus12.7%Acanthochitona aviculasame genus13.4%Acanthochitona hirudiniformissame genus13.4%Acanthochitona fascicularissame genus13.9%Acanthochitona defilippiisame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type262 records

Wild obs. + sensor31

Museum / vouchered231

Range

Area of Occupancy AOO448 km²

Depth

0–200 m sunlit46

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.7 m · max 49.5 m · 46 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 5≤1 km 3≤10 km 2>10 km 7

17 georeferenced · 14 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 10≤1 km 4≤10 km 12>10 km 4

30 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	26
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	12
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
Delaware Museum of Nature and Sciencelocation not on record	9
CASlocation not on record	7
Mexico City, MX	7
Washington, US	6
UM-RSMASlocation not on record	5
Cambridge, US	4
Chicago, US	3
Santa Barbara Museum of Natural Historylocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Ann Arbor, US	1

13 institutions · 92 of 231 vouchered records shown · 33 without an institution code

09Environmental DNA5 detections

Where the DNA of Acanthochitona hemphilli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–25.2

Seasonal swing summer↔winter3.50 °C

Max temp (day)28.0 °C 27.7–28.0

Min temp (night)20.7 °C 20.7–23.1

Precipitation183 mm/mo 107–183

Air humidity66.7 % 62.8–66.7

Moisture balance23.4 mm/mo

Vapour deficit998 Pa 998–1,198

Wind speed2.00 m/s

Cloud cover27.4 % 24.2–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)