Acanthocepola limbata

(Valenciennes, 1835) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cepolidae/Acanthocepola

At a glance

Occurrence records203

Data sources7

Biological traits7

DNA specimens17

eDNA detections4

Sources7 archives

Databases and archives Acanthocepola limbata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

OBISOcean Biodiversity Information System89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS203 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD17 specimens

01Narrative

Acanthocepola limbata is een straalvinnige vissensoort uit de familie van lintvissen (Cepolidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1835 door Valenciennes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length50 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max100 m

Depth min80 m

Vulnerability40

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocepola limbata has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P574 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 110 variable positions, in barcode order

3Tvariable

15Cvariable

18Cvariable

21Tvariable

22Tvariable

24Avariable

30Cmostly conserved

36Amostly conserved

39Cmostly conserved

42Cmostly conserved

45Tmostly conserved

57Amostly conserved

60Gmostly conserved

66Tmostly conserved

72Gmostly conserved

81Cmostly conserved

102Gmostly conserved

105Cmostly conserved

111Amostly conserved

121Tmostly conserved

133Cmostly conserved

141Tmostly conserved

144Gmostly conserved

150Amostly conserved

159Amostly conserved

165Cmostly conserved

174Cmostly conserved

177Tmostly conserved

189Gmostly conserved

192Cmostly conserved

210Tmostly conserved

217Tmostly conserved

222Tmostly conserved

225Tmostly conserved

228Amostly conserved

231Tmostly conserved

234Cmostly conserved

238Gmostly conserved

240Gmostly conserved

243Gmostly conserved

246Gmostly conserved

249Cmostly conserved

252Amostly conserved

256Tmostly conserved

264Cmostly conserved

270Gmostly conserved

274Cmostly conserved

279Gmostly conserved

282Cmostly conserved

286Cmostly conserved

291Amostly conserved

294Tmostly conserved

297Cmostly conserved

309Tmostly conserved

313Tmostly conserved

315Gmostly conserved

316Amostly conserved

321Tmostly conserved

327Cmostly conserved

330Tmostly conserved

336Tmostly conserved

339Cmostly conserved

342Gmostly conserved

348Cmostly conserved

351Amostly conserved

354Tmostly conserved

360Cmostly conserved

363Cmostly conserved

369Cmostly conserved

378Cmostly conserved

390Cmostly conserved

393Amostly conserved

402Tmostly conserved

405Tmostly conserved

414Cmostly conserved

423Amostly conserved

426Cmostly conserved

427Cmostly conserved

429Gmostly conserved

435Gmostly conserved

438Gmostly conserved

445Cmostly conserved

459Cmostly conserved

462Cmostly conserved

465Amostly conserved

468Amostly conserved

471Cmostly conserved

475Cmostly conserved

480Amostly conserved

483Tmostly conserved

486Tmostly conserved

489Amostly conserved

494Gmostly conserved

495Cmostly conserved

501Amostly conserved

504Gmostly conserved

513Cmostly conserved

516Tmostly conserved

522Tmostly conserved

523Tmostly conserved

528Tmostly conserved

531Tmostly conserved

543Cmostly conserved

546Cmostly conserved

552Gvariable

555Avariable

558Avariable

567Cvariable

570Cvariable

573Cvariable

CTTAGCCAACCCGGCCCCTTTTTAGGGGACGATCAAATCTACAATGTAATTGTCACAGCGCATGCTTTTGTGATGATTTTCTTTATAGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.7%

Haplotypes3

BINs2

Most divergent pair18.6%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthocepola indicasame genus7.0%Ecsenius frontalissame order17.4%Novaculichthys taeniourussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type203 records

Wild obs. + sensor39

Museum / vouchered151

Other13

Origin

Native1

Range

Area of Occupancy AOO308 km²

Depth

0–200 m sunlit10

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 25 m · max 400 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1≤1 km 16≤10 km 1

18 georeferenced · 21 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤1 km 12≤10 km 17>10 km 2

31 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	28
Sydney, AU	14
Washington, US	11
Frankfurt am Main	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
CASlocation not on record	3
Yokosuka City Museumlocation not on record	2
Chicago, US	2
Wuzhou, CN	2
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1
University of California San Diegolocation not on record	1
South Kensington, GB	1
National Marine Biodiversity Institute of Korealocation not on record	1
Fisheries Research Laboratory, Mie Universitylocation not on record	1
FishBaselocation not on record	1
Natick, US	1
Museum and Art Gallery of the Northern Territorylocation not on record	1

18 institutions · 77 of 151 vouchered records shown · 5 without an institution code

09Environmental DNA4 detections

Where the DNA of Acanthocepola limbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.2 °C 28.2–28.2

Seasonal swing summer↔winter2.10 °C

Max temp (day)29.7 °C

Min temp (night)26.2 °C

Precipitation160 mm/mo

Air humidity63.8 %

Moisture balance-0.6 mm/mo

Vapour deficit1,385 Pa

Wind speed1.80 m/s

Cloud cover50.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)