Acanthocepola indica

(Day, 1888) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cepolidae/Acanthocepola

At a glance

Occurrence records66

Data sources7

Biological traits6

DNA specimens22

eDNA detections21

Sources7 archives

Databases and archives Acanthocepola indica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

OBISOcean Biodiversity Information System32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS66 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD22 specimens

01Narrative

Acanthocepola indica is een straalvinnige vissensoort uit de familie van lintvissen (Cepolidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1888 door Day.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length55 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Other traits3

Depth max100 m

Depth min50 m

Vulnerability42

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocepola indica has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections21

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

54Gmostly conserved

93Cmostly conserved

108Tmostly conserved

171Gmostly conserved

189Gmostly conserved

204Amostly conserved

210Gmostly conserved

237Cmostly conserved

270Cmostly conserved

277Cmostly conserved

288Cmostly conserved

318Gmostly conserved

324Tmostly conserved

339Amostly conserved

348Gmostly conserved

357Tmostly conserved

375Amostly conserved

378Tmostly conserved

381Cmostly conserved

390Cmostly conserved

405Cmostly conserved

414Cmostly conserved

426Cmostly conserved

471Gvariable

489Amostly conserved

495Amostly conserved

498Amostly conserved

504Amostly conserved

537Gmostly conserved

540Gmostly conserved

543Cmostly conserved

564Amostly conserved

570Cmostly conserved

576Cmostly conserved

582Cmostly conserved

585Amostly conserved

591Cmostly conserved

609Tmostly conserved

612Amostly conserved

618Gmostly conserved

ATATTTGGTGCCTGGGCCGGCATGGTGGGGACAGCCTTAAGTCTCTTAATTCGGGCTGAACTTAGCCAACCCGGCCCCTTTTTAGGGGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes6

BINs2

Most divergent pair6.2%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthocepola limbatasame genus7.0%Paramonacanthus oblongussame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type66 records

Wild obs. + sensor15

Museum / vouchered47

Other4

Range

Area of Occupancy AOO132 km²

Depth

0–200 m sunlit13

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 82.3 m · max 191 m · 13 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤1 km 2>10 km 3

5 georeferenced · 10 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1>10 km 9

10 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	7
South African Institute for Aquatic Biodiversitylocation not on record	4
CASlocation not on record	3
Wuzhou, CN	1
Washington, US	1
University of California San Diegolocation not on record	1
	1

7 institutions · 18 of 47 vouchered records shown · 5 without an institution code

09Environmental DNA21 detections

Where the DNA of Acanthocepola indica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

Marine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 22.7–25.3

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 26.4–30.5

Min temp (night)19.3 °C 19.3–20.0

Precipitation109 mm/mo 11.4–109

Air humidity52.0 % 52.0–60.9

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa 1,233–1,616

Wind speed1.80 m/s

Cloud cover25.2 % 13.4–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)