Acanthobrama telavivensis

Animalia/Chordata/Cypriniformes/Cyprinidae/Acanthobrama

At a glance

Occurrence records105

Data sources6

Biological traits4

DNA specimens11

eDNA detections0

Sources6 archives

Databases and archives Acanthobrama telavivensis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF105 records

DNA & barcodingBOLD11 specimens

01Narrative

Acanthobrama telavivensis, commonly known as the Yarkon bream or Yarkon bleak, is a species of freshwater ray-finned fish of the family Cyprinidae found only in Israel, in the Yarkon River system.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length11 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthobrama telavivensis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P559 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.18%

Where individuals differ — all 1 variable positions, in barcode order

247Avariable

AGGCGATGATCAGATTTACAATGTCATCGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTCTTATTGGAGGGTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthobrama marmidsame genus5.4%Acanthobrama orontissame genus5.5%Blicca bjoerknasame family6.1%Acanthobrama persidissame genus6.1%Vimba melanopssame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type105 records

Wild obs. + sensor84

Museum / vouchered21

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 83 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 17

17 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Natural History Collectionslocation not on record	17
Stockholm, SE	1
Chicago, US	1
Ann Arbor, US	1

4 institutions · 20 of 21 vouchered records shown · 1 without an institution code