Acanthobrama orontis

Berg, 1949 · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Acanthobrama

At a glance

Occurrence records14

Data sources6

Biological traits5

DNA specimens15

eDNA detections11

Sources6 archives

Databases and archives Acanthobrama orontis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD15 specimens

01Narrative

Acanthobrama orontis is a species of freshwater cyprinid fish, which is endemic to Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length17.6 cm

Body mass57.38 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthobrama orontis has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

118Cmostly conserved

211Cmostly conserved

226Gmostly conserved

287Cmostly conserved

415Amostly conserved

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGGACTGCCCTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCCGGGTCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes3

BIN1

Most divergent pair0.77%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthobrama marmidsame genus2.1%Acanthobrama persidissame genus3.2%Blicca bjoerknasame family3.4%Vimba vimbasame family4.8%Acanthobrama lissnerisame genus4.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PRho

animal barcodemarker

08Occurrence & distribution

Record type14 records

Museum / vouchered14

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	12

1 institutions · 12 of 14 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Acanthobrama orontis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–19.0

Seasonal swing summer↔winter19.6 °C

Max temp (day)23.1 °C 23.1–23.4

Min temp (night)13.6 °C 13.6–13.8

Precipitation73.7 mm/mo 58.3–73.7

Air humidity56.9 % 56.9–57.5

Moisture balance-35.6 mm/mo -55.5–-35.6

Vapour deficit1,018 Pa 1,001–1,018

Wind speed1.90 m/s 1.90–2.40

Cloud cover31.5 % 31.5–31.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)