Acanthephyra purpurea

A.Milne-Edwards, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Acanthephyridae/Acanthephyra

At a glance

Occurrence records2 116

Data sources9

Biological traits4

DNA specimens31

eDNA detections65

Sources9 archives

Databases and archives Acanthephyra purpurea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 075 records↗

OBISOcean Biodiversity Information System1 041 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF · OBIS2 116 records

Environmental DNA1 datasets · 4 countries65 detections

DNA & barcodingBOLD31 specimens

01Narrative

Acanthephyra purpurea is a species of deep sea shrimp described in 1881.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max3 292 m

Depth min300 m

03Chemical composition1 compounds

Compounds documented for Acanthephyra purpurea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carotenoids (C40, β-β)1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Astaxanthin		present	LOTUS

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthephyra purpurea has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections65

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P659 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

57Cmostly conserved

242Amostly conserved

290Gmostly conserved

356Amostly conserved

503Tmostly conserved

569Tmostly conserved

GAACATTATATTTTATTTTCGGTGCATGAGCCGGAATGGTAGGTACTGCCTTGAGACTATTAATTCGGGCTGAACTTGGACAACCAGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes8

BIN1

Most divergent pair0.91%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthephyra pelagicasame genus9.1%Acanthephyra acanthitelsonissame genus9.3%Deosergestes corniculumsame order17.2%Galathea ahyongisame order17.5%Metapenaeopsis aegyptiasame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 116 records

Wild obs. + sensor480

Museum / vouchered1 457

Cultivated / captive19

Other160

Origin

Native91

Range

Area of Occupancy AOO5 408 km²

Depth

0–200 m sunlit155

200–1000 m twilight550

1–4 km midnight210

>4 km abyssal25

median 550.6 m · max 5 370 m · 940 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 9>10 km 6

15 georeferenced · 465 without coordinates

Open the mapobservation + sensor480

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 4≤1 km 3≤10 km 35>10 km 37

79 georeferenced · 1 378 without coordinates

Open the institutions mapphysical evidence1 457

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 19 records without

Open the mapnot free-living19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	369
The Atlantic reference Centrelocation not on record	131
Texas Cooperative Wildlife Collectionlocation not on record	91
Cambridge, US	59
Xlocation not on record	59
New Haven, US	45
IPMAlocation not on record	25
Museum für Naturkunde Berlin (Zoological Collections)location not on record	13
	9
Paris, FR	9
South Kensington, GB	4
UM-RSMASlocation not on record	4
Maurice Lamontagne Institutelocation not on record	3
Saint John, CA	3
IEO-COMA-CSIClocation not on record	3
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
Brussels, BE	2
IEOlocation not on record	2
Earth Sciences New Zealandlocation not on record	2
Mexico City, MX	2
RBINS-Scientific Heritagelocation not on record	1
Toronto, CA	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Stockholm, SE	1

25 institutions · 843 of 1 457 vouchered records shown · 121 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA65 detections

Where the DNA of Acanthephyra purpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 18.2–24.4

Seasonal swing summer↔winter4.80 °C

Max temp (day)21.4 °C 19.4–24.9

Min temp (night)20.5 °C 17.2–23.5

Precipitation22.0 mm/mo 12.7–130

Air humidity58.8 % 57.7–69.7

Vapour deficit1,041 Pa 647–1,260

Cloud cover34.6 % 22.1–39.5

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthephyra purpurea

At a glance

Sources9 archives

Habitat & environment2

Other traits2

Compound class profile1 class

Documented compounds1 total

At a glance

Record type2 116 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 116 records