Acanthephyra pelagica

(Risso, 1816) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Acanthephyridae/Acanthephyra

At a glance

Occurrence records5 440

Data sources6

Biological traits4

DNA specimens28

eDNA detections23

Sources6 archives

Databases and archives Acanthephyra pelagica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 441 records↗

OBISOcean Biodiversity Information System3 999 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS5 440 records

Environmental DNA1 datasets · 4 countries23 detections

DNA & barcodingBOLD28 specimens

01Narrative

Acanthephyra pelagica is een garnalensoort uit de familie van de Acanthephyridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1816 door Risso.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits2

Depth max2 500 m

Depth min183 m

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthephyra pelagica has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes2

eDNA detections23

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

31Cmostly conserved

82Avariable

94Gmostly conserved

130Tmostly conserved

157Cmostly conserved

208Amostly conserved

229Gmostly conserved

235Cmostly conserved

313Amostly conserved

322Amostly conserved

325Amostly conserved

347Tmostly conserved

400Amostly conserved

412Gmostly conserved

550Gvariable

643Amostly conserved

AACACTATACTTCATTTTTGGTGCATGAGCCGGAATAGTAGGTACTGCCTTAAGACTCCTAATTCGAGCTGAGCTTGGACAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes6

BINs2

Most divergent pair2.4%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthephyra acanthitelsonissame genus2.1%Acanthephyra purpureasame genus9.1%Acanthephyra stylorostratissame genus15.3%Galathea subsquamatasame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type5 440 records

Wild obs. + sensor3 653

Museum / vouchered1 225

Other562

Origin

Native1

Range

Area of Occupancy AOO14 836 km²

Depth

0–200 m sunlit135

200–1000 m twilight2 074

1–4 km midnight1 576

>4 km abyssal28

median 948.2 m · max 5 330 m · 3 813 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 458≤1 km 10≤10 km 12>10 km 9

489 georeferenced · 3 164 without coordinates

Open the mapobservation + sensor3 653

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 27≤10 km 25>10 km 2

54 georeferenced · 1 171 without coordinates

Open the institutions mapphysical evidence1 225

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The Atlantic reference Centrelocation not on record	192
Washington, US	189
Earth Sciences New Zealandlocation not on record	35
Xlocation not on record	34
IEOlocation not on record	32
New Haven, US	22
ICM-CSIClocation not on record	18
The Atlantic Reference Centre (ARC)location not on record	16
ICATMARlocation not on record	12
ICMlocation not on record	10
Maurice Lamontagne Institutelocation not on record	9
Paris, FR	7
IEO-COMA-CSIClocation not on record	7
Cambridge, US	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
South Kensington, GB	4
Saint John, CA	4
Instituto de Investigaciones Marinas y Costeras, CONICET-Universidad Nacional de Mar del Plata/Facultad de Ciencias Exactas y Naturaleslocation not on record	3
AUTHlocation not on record	3
	3
IPMAlocation not on record	2
Natural History Museum, Londonlocation not on record	2
SCSDlocation not on record	2
Copenhagen, DK	1
Texas Cooperative Wildlife Collectionlocation not on record	1

25 institutions · 617 of 1 225 vouchered records shown · 12 without an institution code

09Environmental DNA23 detections

Where the DNA of Acanthephyra pelagica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 12.2–19.2

Seasonal swing summer↔winter15.8 °C

Max temp (day)18.9 °C 12.9–20.2

Min temp (night)11.6 °C 10.2–18.6

Precipitation111 mm/mo 65.1–123

Air humidity64.2 % 62.6–70.3

Vapour deficit609 Pa 509–758

Cloud cover41.8 % 39.1–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthephyra pelagica

At a glance

Sources6 archives

Habitat & environment2

Other traits2

At a glance

Record type5 440 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 440 records