Acanalonia bivittata

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Acanaloniidae/Acanalonia

At a glance

Occurrence records3 734

Data sources7

Biological traits0

DNA specimens122

eDNA detections116

Sources7 archives

Databases and archives Acanalonia bivittata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 734 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI116 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics122 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 734 records

Environmental DNA1 datasets · 3 countries116 detections

DNA & barcodingBOLD122 specimens

01Narrative

Acanalonia bivittata, the two-striped planthopper, is a species of planthopper in the family Acanaloniidae, and the most common and widespread member of the genus Acanalonia. Adults of this species are typically green, though occasionally pink. There is a reddish stripe on the inner edge of the wing.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding122 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanalonia bivittata has left across the world's sequence archives.

At a glance

DNA specimens122

BINs2

Marker genes3

eDNA detections116

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 133 variable positions, in barcode order

5Cmostly conserved

7Tmostly conserved

10Cmostly conserved

16Cmostly conserved

19Gmostly conserved

35Amostly conserved

37Amostly conserved

38Gmostly conserved

40Cmostly conserved

55Tmostly conserved

56Gmostly conserved

58Tmostly conserved

70Tmostly conserved

73Avariable

79Tmostly conserved

85Amostly conserved

88Tmostly conserved

106Tmostly conserved

112Cmostly conserved

121Amostly conserved

127Tmostly conserved

133Amostly conserved

136Cmostly conserved

143Amostly conserved

145Tmostly conserved

157Tmostly conserved

163Tmostly conserved

169Amostly conserved

178Cmostly conserved

181Avariable

184Gmostly conserved

190Amostly conserved

197Cmostly conserved

206Amostly conserved

223Gmostly conserved

232Tmostly conserved

235Tvariable

238Cmostly conserved

263Tmostly conserved

266Tmostly conserved

268Amostly conserved

271Cmostly conserved

278Tmostly conserved

280Amostly conserved

287Tmostly conserved

289Amostly conserved

290Amostly conserved

292Tmostly conserved

293Amostly conserved

298Tmostly conserved

301Tmostly conserved

305Gmostly conserved

307Gmostly conserved

310Amostly conserved

313Gmostly conserved

316Gmostly conserved

318Cmostly conserved

325Tmostly conserved

328Gmostly conserved

334Amostly conserved

337Amostly conserved

343Cmostly conserved

349Amostly conserved

352Amostly conserved

355Amostly conserved

356Cmostly conserved

357Amostly conserved

358Amostly conserved

360Tmostly conserved

361Cmostly conserved

364Amostly conserved

370Amostly conserved

373Amostly conserved

376Cmostly conserved

382Tmostly conserved

388Gmostly conserved

391Gmostly conserved

394Cmostly conserved

401Cmostly conserved

403Tmostly conserved

406Cmostly conserved

412Cmostly conserved

416Gmostly conserved

433Tvariable

436Tmostly conserved

439Tmostly conserved

442Tmostly conserved

446Amostly conserved

454Amostly conserved

459Tmostly conserved

460Amostly conserved

471Cmostly conserved

472Cmostly conserved

474Gmostly conserved

475Gmostly conserved

479Amostly conserved

484Cmostly conserved

496Gmostly conserved

499Amostly conserved

505Cmostly conserved

512Gmostly conserved

514Tmostly conserved

518Cmostly conserved

520Cmostly conserved

526Amostly conserved

530Gmostly conserved

532Cmostly conserved

539Gmostly conserved

541Gmostly conserved

544Gmostly conserved

548Cmostly conserved

550Gmostly conserved

553Tmostly conserved

556Amostly conserved

557Cmostly conserved

559Gmostly conserved

565Tmostly conserved

571Cmostly conserved

574Cmostly conserved

581Cmostly conserved

+13 more variable positions not shown

TACACTTTACTTTATCTTGGGACTATGATCAGGAATAGTCGGAACAATAATAAGTGTTATTATTCGAATTGAATTATCTCAACCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes14

BINs2

Most divergent pair20.5%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanalonia conicasame genus16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type3 734 records

Wild obs. + sensor2 720

Museum / vouchered1 014

Range

Area of Occupancy AOO9 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 396≤1 km 499≤10 km 139>10 km 237

2 271 georeferenced · 449 without coordinates

Open the mapobservation + sensor2 720

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 59≤1 km 98≤10 km 169>10 km 1

327 georeferenced · 687 without coordinates

Open the institutions mapphysical evidence1 014

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	298
OSUClocation not on record	168
North Carolina State University Insect Museumlocation not on record	160
University Park, US	90
Mississippi State, US	70
University of Guelph, Centre for Biodiversity Genomicslocation not on record	49
University of Guelphlocation not on record	39
Montgomery, US	30
Cambridge, US	16
Wuzhou, CN	7
Musee des Dinosaures d'Esperaza (Aude)location not on record	2
Natural History Museum of Utahlocation not on record	2
CUlocation not on record	2
Provo, US	2
Cornell University Insect Collectionlocation not on record	2
ASUlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1

17 institutions · 940 of 1 014 vouchered records shown · 74 without an institution code

09Environmental DNA116 detections

Where the DNA of Acanalonia bivittata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found116

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 116 detections have coordinates

Open the map3 countries0

Mixed habitatGrasslandForest14. Artificial - Terrestrial|14.5 Urban AreasMeadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 15.2–21.9

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.9 °C 20.6–25.9

Min temp (night)14.0 °C 11.8–19.6

Precipitation87.7 mm/mo 75.6–91.8

Air humidity59.8 % 58.0–60.5

Moisture balance-10.2 mm/mo -76.0–-1.60

Vapour deficit758 Pa 687–1,054

Wind speed3.20 m/s 2.60–4.80

Cloud cover47.6 % 37.5–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 112 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanalonia bivittata

At a glance

Sources7 archives

At a glance

Record type3 734 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 734 records