Acanalonia conica

(Say, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Acanaloniidae/Acanalonia

At a glance

Occurrence records9 511

Data sources7

Biological traits0

DNA specimens154

eDNA detections153

Sources7 archives

Databases and archives Acanalonia conica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 511 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI153 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics154 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 511 records

Environmental DNA1 datasets · 3 countries153 detections

DNA & barcodingBOLD154 specimens

01Narrative

Acanalonia conica is a species of acanaloniid planthopper in the family Acanaloniidae. It is found in North America and Europe. Acanalonia conica

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding154 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanalonia conica has left across the world's sequence archives.

At a glance

DNA specimens154

BINs1

Marker genes1

eDNA detections153

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus146 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

103Cvariable

118Tmostly conserved

145Tmostly conserved

263Cvariable

347Tvariable

364Tvariable

421Tvariable

446Avariable

448Cvariable

458Tmostly conserved

539Cvariable

571Tvariable

616Tvariable

631Gvariable

649Gvariable

652Cvariable

AACACTTTATTTTATTTTAGGGTTATGATCAGGAATAATTGGGACAATAATAAGAATAATTATTCGTATTGAATTATCTCAGCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes22

BIN1

Most divergent pair4.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scolops viridissame order14.7%Metcracis humeralissame order16.0%Scolops sulcipessame order16.3%Scolops luridussame order16.4%Hysteropterum reticulatumsame order16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 511 records

Wild obs. + sensor8 887

Museum / vouchered624

Range

Area of Occupancy AOO23 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 4 746≤1 km 1 014≤10 km 361>10 km 1 150

7 271 georeferenced · 1 616 without coordinates

Open the mapobservation + sensor8 887

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 30≤1 km 40≤10 km 195>10 km 1

266 georeferenced · 358 without coordinates

Open the institutions mapphysical evidence624

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	261
OSUClocation not on record	144
Mississippi State, US	37
University Park, US	33
University of Guelph, Centre for Biodiversity Genomicslocation not on record	29
Cambridge, US	21
University of Guelphlocation not on record	16
College Station, US	14
UDlocation not on record	13
Provo, US	3
Cornell University Insect Collectionlocation not on record	3
CUlocation not on record	2
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	2
Montgomery, US	1
San Luis Potosí, MX	1
National Museum of Natural History, Bulgarian Academy of Scienceslocation not on record	1
Philadelphia, US	1
Tartu, EE	1
South Kensington, GB	1
University of Central Floridalocation not on record	1

20 institutions · 585 of 624 vouchered records shown · 39 without an institution code

09Environmental DNA153 detections

Where the DNA of Acanalonia conica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found153

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 153 detections have coordinates

Open the map3 countries0

Mixed habitat14. Artificial - Terrestrial | 14.2 Pasturel…1. Forest & Woodland|1.4. Temperate ForestForestCity gardenUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 16.8–24.3

Seasonal swing summer↔winter26.2 °C

Max temp (day)25.5 °C 21.8–29.0

Min temp (night)18.0 °C 12.9–20.4

Precipitation109 mm/mo 88.6–125

Air humidity57.3 % 56.3–59.8

Moisture balance-45.8 mm/mo -66.1–-8.70

Vapour deficit1,090 Pa 786–1,258

Wind speed2.80 m/s 2.50–3.80

Cloud cover37.8 % 31.3–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 152 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanalonia conica

At a glance

Sources7 archives

At a glance

Record type9 511 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 511 records