Acalypta parvula

(Fallén, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Tingidae/Acalypta

At a glance

Occurrence records2 780

Data sources8

Biological traits2

DNA specimens27

eDNA detections70

Sources8 archives

Databases and archives Acalypta parvula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 780 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 780 records

Environmental DNA4 datasets · 6 countries70 detections

DNA & barcodingBOLD27 specimens

01Narrative

Acalypta parvula is a species of lace bug in the family Tingidae. It is found in Africa, Europe and Northern Asia (excluding China), and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalypta parvula has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections70

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P597 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

1Amostly conserved

2Tmostly conserved

95Tmostly conserved

207Amostly conserved

318Amostly conserved

450Gmostly conserved

558Cmostly conserved

573Tmostly conserved

ATTATTCGAATTGAACTAAGACAACCAGGGCCATTTATTGGAAATGATCAAATTTATAACGTAATCGTTACAGCACACGCATTTATTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes6

BIN1

Most divergent pair0.67%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dictyonota strichnocerasame family15.6%Stephanitis chinensissame family15.6%Acalypta platycheilasame genus16.6%Catoplatus fabriciisame family16.9%Phytocoris husseyisame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 780 records

Wild obs. + sensor1 786

Museum / vouchered835

Cultivated / captive5

Fossil2

Other152

Origin

Native39

Range

Area of Occupancy AOO5 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 737≤1 km 468≤10 km 442>10 km 7

1 654 georeferenced · 132 without coordinates

Open the mapobservation + sensor1 786

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 203≤1 km 123≤10 km 247>10 km 11

584 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence835

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	252
Natural History Museum, Aarhus Denmarklocation not on record	85
NHMOlocation not on record	65
Metsähallituslocation not on record	49
SLU Artdatabankenlocation not on record	46
UAclocation not on record	39
John May Museum of Natural Historylocation not on record	38
Vancouver, CA	23
Bonn, DE	12
Philadelphia, US	10
CBDClocation not on record	10
BioFokuslocation not on record	8
ZMAAlocation not on record	7
Tartu, EE	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
ZSMlocation not on record	5
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	4
neflocation not on record	4
MZLUlocation not on record	3
South Kensington, GB	3
NCMGlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
NTNU-VMlocation not on record	2
Trondheim, NO	1
Helsinki, FI	1
Tallinn, EE	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Natural History Museum Rotterdamlocation not on record	1
Departamento de Zoologia, Universidad de La Lagunalocation not on record	1

30 institutions · 689 of 835 vouchered records shown · 146 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA70 detections

Where the DNA of Acalypta parvula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys4

Countries6

Verifiable raw sequence linked53

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map6 countries0

1. Forest & WoodlandForestMixed habitatWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.8–16.9

Seasonal swing summer↔winter17.7 °C

Max temp (day)19.5 °C 16.2–20.5

Min temp (night)12.5 °C 9.90–15.6

Precipitation74.8 mm/mo 45.2–89.2

Air humidity61.5 % 60.6–63.5

Moisture balance-16.9 mm/mo -86.6–-5.70

Vapour deficit724 Pa 568–741

Wind speed2.60 m/s 2.20–5.10

Cloud cover42.6 % 40.5–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acalypta parvula

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type2 780 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 780 records