Acalymma vittatum

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Acalymma

At a glance

Occurrence records4 693

Data sources10

Biological traits0

DNA specimens49

eDNA detections86

Sources10 archives

Databases and archives Acalymma vittatum's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 693 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF4 693 records

Environmental DNA1 datasets · 7 countries86 detections

DNA & barcodingBOLD49 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Acalymma vittatum, the striped cucumber beetle, is a beetle of the family Chrysomelidae and a serious pest of cucurbit crops in both larval and adult stages.Walz, E. (1999), Final Results of the Third Biennial National Organic Farmers’ Survey, Santa Cruz, CA: Organic Farming Research Foundation. It is distributed from eastern North America to the Rocky Mountains. It is replaced in the west by Acalymma trivittatum, a duller species often with greyish or pale white elytra rather than yellow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition3 compounds

Compounds documented for Acalymma vittatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Lactones $ Open-chain polyketides2

Open-chain polyketides1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,4R)-3-methyl-4-[(2R,4S,6R)-4,6,8-trimethylnonan-2-yl]oxetan-2-one	present	LOTUS
(3R,4R)-3-methyl-4-[(2R,4S,6S)-4,6,8-trimethylnonan-2-yl]oxetan-2-one	present	LOTUS
(3R,4R)-4-[(2R,4S,6S)-4,6-dimethylnonan-2-yl]-3-methyloxetan-2-one	present	LOTUS

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalymma vittatum has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes2

eDNA detections86

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

9Tmostly conserved

21Gmostly conserved

39Amostly conserved

72Amostly conserved

81Gmostly conserved

84Amostly conserved

156Cmostly conserved

165Gmostly conserved

180Amostly conserved

234Tmostly conserved

297Gmostly conserved

315Amostly conserved

339Cmostly conserved

387Amostly conserved

534Gmostly conserved

549Amostly conserved

618Tmostly conserved

630Gvariable

633Tmostly conserved

645Tmostly conserved

ACTTTATATTTTATTTTTGGGATTTGAGCAGGAATAGTAGGAACTTCTTTAAGAATCCTAATTCGAGCTGAACTAGGAAGGCCAGGTTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes14

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhagium inquisitorsame order13.1%Metaxmeste schrankianasame order13.3%Hydrotaea velutinasame order14.2%Nola adelphasame order14.3%Nola pustulatasame order14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Acalymma vittatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–282n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 213×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

2n 223×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

2n 281×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type4 693 records

Wild obs. + sensor4 117

Museum / vouchered576

Range

Area of Occupancy AOO12 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 2 279≤1 km 543≤10 km 153>10 km 509

3 484 georeferenced · 633 without coordinates

Open the mapobservation + sensor4 117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 5≤1 km 43≤10 km 212>10 km 75

335 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence576

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	179
South Kensington, GB	100
University Park, US	86
University of Guelphlocation not on record	27
University of Guelph, Centre for Biodiversity Genomicslocation not on record	22
Wuzhou, CN	21
Lubbock, US	21
Denver, US	19
Universidad Católica de Manizaleslocation not on record	19
Espace pour la vielocation not on record	8
Cambridge, US	6
Philadelphia, US	5
Ciudad de México, MX	5
Royal Saskatchewan Museumlocation not on record	5
University of Central Floridalocation not on record	4
Mexico City, MX	4
Museo del Instituto de Zoologia Agricola Francisco Fernandez Yepezlocation not on record	3
Chicago, US	3
OSUClocation not on record	3
Cornell University Insect Collectionlocation not on record	2
Saint John, CA	2
CUlocation not on record	2
Toronto, CA	1
SOVTlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Denver, US	1

26 institutions · 550 of 576 vouchered records shown · 26 without an institution code

09Environmental DNA86 detections

Where the DNA of Acalymma vittatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map7 countries0

Grassland14. Artificial - Terrestrial | 14.2 Pasturel…Mixed habitatWetland1. Forest & Woodland|1.6. Subtropical/Tropic…trockene Eichewalder

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 8.60–21.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C 13.3–25.9

Min temp (night)11.4 °C 5.60–16.6

Precipitation75.6 mm/mo 33.4–101

Air humidity59.0 % 52.9–61.5

Moisture balance-38.0 mm/mo -70.6–25.8

Vapour deficit773 Pa 465–1,073

Wind speed3.20 m/s 2.00–4.40

Cloud cover38.3 % 34.3–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acalymma vittatum

At a glance

Sources10 archives

Compound class profile2 classes

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 693 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 693 records