Abrostola urentis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abrostola

At a glance

Occurrence records951

Data sources7

Biological traits0

DNA specimens18

eDNA detections18

Sources7 archives

Databases and archives Abrostola urentis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility951 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF951 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Abrostola urentis, the spectacled nettle moth or variegated brindle, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found in North America from Nova Scotia west across Canada to Vancouver Island, south to North Carolina, Missouri, Texas, Colorado and Oregon. The wingspan is 30–32 mm. Adults are on wing from June to July in one generation depending on the location. The larvae feed on Urtica dioica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abrostola urentis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.16%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

43Amostly conserved

205Amostly conserved

212Cmostly conserved

433Amostly conserved

529Gmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abrostola tripartitasame genus5.6%Abrostola ovalissame genus6.1%Abrostola agnoristasame genus6.5%Abrostola triplasiasame genus6.7%Lascoria niveasame order7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type951 records

Wild obs. + sensor580

Museum / vouchered371

Range

Area of Occupancy AOO1 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 368≤1 km 81≤10 km 19>10 km 36

504 georeferenced · 76 without coordinates

Open the mapobservation + sensor580

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 1≤1 km 53≤10 km 73>10 km 13

140 georeferenced · 231 without coordinates

Open the institutions mapphysical evidence371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	101
University of Alberta Museums (UAM)location not on record	83
St. Paul, US	31
New Haven, US	28
King Saud Universitylocation not on record	24
Oregon State Arthropod Collectionlocation not on record	20
Royal Saskatchewan Museumlocation not on record	13
Cleveland Museum of Natural History, OH (CLEV)location not on record	11
Decorah, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Toronto, CA	6
Cornell University Insect Collectionlocation not on record	4
WWUlocation not on record	4
National Institute of Biological Resourceslocation not on record	2
Mississippi State, US	2
OSUClocation not on record	1
Helsinki, FI	1
Colorado State Universitylocation not on record	1
University of California, Davislocation not on record	1
SOVTlocation not on record	1

20 institutions · 349 of 371 vouchered records shown · 22 without an institution code

09Environmental DNA18 detections

Where the DNA of Abrostola urentis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

1. Forest & Woodland4. Native GrasslandTemperate mixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 14.4–21.0

Seasonal swing summer↔winter28.7 °C

Max temp (day)23.7 °C 19.9–25.8

Min temp (night)14.1 °C 9.70–17.5

Precipitation85.9 mm/mo 79.2–120

Air humidity57.8 % 55.2–59.8

Moisture balance-48.1 mm/mo -64.1–10.5

Vapour deficit888 Pa 733–1,025

Wind speed2.50 m/s 2.10–3.60

Cloud cover41.5 % 36.6–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)