Abrostola ovalis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abrostola

At a glance

Occurrence records125

Data sources7

Biological traits0

DNA specimens11

eDNA detections12

Sources7 archives

Databases and archives Abrostola ovalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD11 specimens

01Narrative

Abrostola ovalis, the oval abrostola, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found in north-eastern North America from southern Quebec and Maine south to North Carolina and west to Wisconsin. The wingspan is about 30 mm. Adults are on wing from May to August. There is one generation per year in the north. There might be a partial second generation or two full generations in the south. The larvae feed on Urtica dioica and probably other nettle species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abrostola ovalis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

430Cmostly conserved

565Amostly conserved

628Amostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abrostola agnoristasame genus4.7%Abrostola triplasiasame genus5.2%Abrostola asclepiadissame genus5.3%Abrostola urentissame genus6.1%Abrostola tripartitasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type125 records

Wild obs. + sensor87

Museum / vouchered38

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 35≤1 km 14≤10 km 17>10 km 11

77 georeferenced · 10 without coordinates

Open the mapobservation + sensor87

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 2≤1 km 8≤10 km 4

14 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	8
East Lansing, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Decorah, US	3
Ciudad de México, MX	2
New Haven, US	2
King Saud Universitylocation not on record	1
University of Alberta Museums (UAM)location not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
St. Paul, US	1
Washington, US	1

11 institutions · 28 of 38 vouchered records shown · 10 without an institution code

09Environmental DNA12 detections

Where the DNA of Abrostola ovalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 17.7–22.4

Seasonal swing summer↔winter24.7 °C

Max temp (day)24.1 °C 21.9–27.2

Min temp (night)14.8 °C 13.4–17.9

Precipitation115 mm/mo 84.7–153

Air humidity58.2 % 57.7–63.6

Moisture balance-43.1 mm/mo -58.9–10.9

Vapour deficit936 Pa 752–1,087

Wind speed2.80 m/s 1.50–3.50

Cloud cover36.3 % 27.1–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)