Abramis brama

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Abramis

At a glance

Occurrence records411 189

Data sources14

Biological traits0

DNA specimens121

eDNA detections123

Sources14 archives

Databases and archives Abramis brama's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility409 854 records↗

OBISOcean Biodiversity Information System1 335 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI123 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics121 specimens↗

FooDBThe Metabolomics Innovation Centrecompounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionFooDB · NPASS87 compounds

Occurrence & distributionGBIF · OBIS411 189 records

Environmental DNA3 datasets · 16 countries123 detections

DNA & barcodingBOLD121 specimens

Genome at a glanceGoaT · NCBI1.3 Gbp

01Narrative

The common bream, freshwater bream, bream, bronze bream, or carp breamFishBase, Common names of Abramis brama. Retrieved 2010-11-13. (Abramis brama), is a European species of freshwater fish in the family Cyprinidae. It is now considered to be the only species in the genus Abramis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition87 compounds

Compounds documented for Abramis brama across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingAquatic foods

Compound class profile5 classes

Unsaturated fatty acids21

Aminoacids14

Branched fatty acids $ Unsaturated fatty acids12

Pyridine alkaloids9

Prenyl quinone meroterpenoids6

Documented compounds87 total

Tissue Source Quantified only

Compound	Amount	Source
Cholesterol	66,000 mg/100 g	FooDB
Nitrogen	2,700 mg/100 g	FooDB
Potassium	350 mg/100 g	FooDB
(R)-Oxypeucedanin	210 mg/100 g	FooDB
Phosphorus	210 mg/100g	FooDB
alpha-Linolenic acid	94 mg/100 g	FooDB
(Z,Z)-9,12-Octadecadienoic acid	76 mg/100g	FooDB

05DNA & barcoding121 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abramis brama has left across the world's sequence archives.

At a glance

DNA specimens121

BINs1

Marker genes11

eDNA detections123

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus106 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

202Avariable

287Cmostly conserved

592Tmostly conserved

610Cmostly conserved

643Tmostly conserved

CCTTTATCTTGTATTTGGTGCCTGAGCTGGAATAGTGGGGACTGCCCTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCCGGGTCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes8

BIN1

Most divergent pair0.92%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Blicca bjoerknasame family4.0%Vimba vimbasame family5.5%Vimba melanopssame family5.7%Capoetobrama kuschakewitschisame family5.8%Acanthobrama orontissame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_020356 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Abramis brama carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 271 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Abramis brama1.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Chromosome records50–522n range51median50mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 502×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

2n 522×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

2n 511×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.9% BUSCO

08Occurrence & distribution

Record type411 189 records

Wild obs. + sensor406 747

Museum / vouchered1 537

Cultivated / captive1

Fossil7

Other2 897

Origin

Native2 296

Introduced398

Range

Area of Occupancy AOO104 412 km²

Depth

0–200 m sunlit990

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6 m · max 32 m · 990 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 169 979≤1 km 199 610≤10 km 26 452>10 km 447

396 488 georeferenced · 10 259 without coordinates

Open the mapobservation + sensor406 747

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 56≤10 km 69>10 km 78

206 georeferenced · 1 331 without coordinates

Open the institutions mapphysical evidence1 537

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	456
Stockholm, SE	184
Bonn, DE	146
SNSB-Zoologische Staatssammlung Münchenlocation not on record	95
Zoologisches Museum Hamburglocation not on record	92
	90
Frankfurt am Main	32
Helsinki, FI	22
Kuopio, FI	21
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	20
Fribourg, CH	16
Toronto, CA	13
Geneva, CH	13
Brussels, BE	13
RBINS-Scientific Heritagelocation not on record	9
730location not on record	7
Universität Zürich, Naturhistorisches Museumlocation not on record	6
CEFElocation not on record	6
Cambridge, US	6
South Kensington, GB	6
Ann Arbor, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
ZSMlocation not on record	5
Mexico City, MX	4
Paris, FR	3
Vancouver, CA	3
MZLUlocation not on record	3
Nizhyn Gogol State Universitylocation not on record	3
Musee d'Histoire Naturallelocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Dhaka, BD	2
Naturmuseum Solothurnlocation not on record	2
Frauenfeld, CH	2
CASlocation not on record	2
Copenhagen, DK	2
Oberoesterreichisches Landesmuseum, Biologiezentrum, Linzlocation not on record	2
North Carolina Museum of Natural Scienceslocation not on record	1
Oulu, FI	1
Ugentlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Forssa, FI	1
PUC-RSlocation not on record	1
NTNU-VMlocation not on record	1
Ohio State University - Fish Division, Columbus, OH (OSUM)location not on record	1
Chicago, US	1
National Museum of Natural History, Praguelocation not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
University of California San Diegolocation not on record	1
University of Nebraskalocation not on record	1

49 institutions · 1 313 of 1 537 vouchered records shown · 172 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA123 detections

Where the DNA of Abramis brama was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found123

Studies independent surveys3

Countries16

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 123 detections have coordinates

Open the map16 countries0

river

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 6.60–17.6

Seasonal swing summer↔winter20.1 °C

Max temp (day)15.6 °C 9.00–21.8

Min temp (night)7.50 °C 1.60–12.9

Precipitation62.7 mm/mo 33.2–94.5

Air humidity60.4 % 56.3–65.2

Moisture balance-16.3 mm/mo -62.5–81.7

Vapour deficit591 Pa 349–886

Wind speed3.20 m/s 2.20–4.80

Cloud cover42.5 % 30.8–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 103 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abramis brama

At a glance

Sources14 archives

Compound class profile5 classes

Documented compounds87 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type411 189 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type411 189 records