Abdopus aculeatus

(d'Orbigny, 1834) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Abdopus

At a glance

Occurrence records76

Data sources8

Biological traits6

DNA specimens4

eDNA detections24

Sources8 archives

Databases and archives Abdopus aculeatus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

OBISOcean Biodiversity Information System26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS76 records

Environmental DNA1 datasets · 3 countries24 detections

DNA & barcodingBOLD4 specimens

01Narrative

Abdopus aculeatus is a small octopus species in the order Octopoda. A. aculeatus has the common name of algae octopus due to its typical resting camouflage, which resembles a gastropod shell overgrown with algae. It is small in size with a mantle around the size of a small orange (≈7 cm) and legs 25 cm in length, and is adept at mimicking its surroundings. A. aculeatus has been described as "the only land octopus", because it lives on beaches, walking from one tidal pool to the next as it hunts for crab. Many octopuses can crawl short distances on land when necessary, but no others do so routinely.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length43 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importanceminor commercial

Other traits2

Depth max17 m

Depth min0 m

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abdopus aculeatus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections24

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ACATTATATTTCATCTTCGGAATTTGATCAGGCCTCTTAGGAACCTCTTTAAGACTAATAATCCGAACAGAACTAGGACAACCCGGATCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Octopus laqueussame family6.4%Thaumoctopus mimicussame family12.2%Macrotritopus defilippisame family12.2%Abdopus abaculussame genus13.1%Octopus hummelinckisame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type76 records

Wild obs. + sensor42

Museum / vouchered34

Range

Area of Occupancy AOO148 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 1 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 16≤1 km 14≤10 km 5

35 georeferenced · 7 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 5≤1 km 7>10 km 1

13 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	8
Sydney, AU	5
Museums Victorialocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Cambridge, US	1
CASlocation not on record	1

6 institutions · 18 of 34 vouchered records shown

09Environmental DNA24 detections

Where the DNA of Abdopus aculeatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map3 countries0

Rubble

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 27.2–27.4

Seasonal swing summer↔winter2.50 °C

Max temp (day)28.0 °C 27.9–28.2

Min temp (night)26.2 °C 26.2–26.4

Precipitation325 mm/mo 307–375

Air humidity65.5 % 63.5–65.5

Vapour deficit1,236 Pa 1,236–1,322

Cloud cover67.2 % 58.6–75.9

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)