Abdopus abaculus

(Norman & Sweeney, 1997) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Abdopus

At a glance

Occurrence records46

Data sources7

Biological traits6

DNA specimens8

eDNA detections1

Sources7 archives

Databases and archives Abdopus abaculus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

OBISOcean Biodiversity Information System18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS46 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD8 specimens

01Narrative

Abdopus abaculus est une espèce de céphalopodes octopodes appartenant à la famille des Octopodidés (Octopodidae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length3.3 cm

Body mass21 g

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max5 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abdopus abaculus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.36%

Haplotypes2

BIN1

Most divergent pair1.2%

Where individuals differ — all 8 variable positions, in barcode order

181Amostly conserved

250Tmostly conserved

286Amostly conserved

316Gmostly conserved

322Amostly conserved

494Cmostly conserved

631Amostly conserved

634Cmostly conserved

TACACTATATTTTATTTTTGGAATTTGATCAGGACTTCTAGGAACTTCACTAAGATTAATAATCCGAACAGAACTAGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Octopus laqueussame family10.8%Octopus cyaneasame family11.8%Macrotritopus defilippisame family12.2%Thaumoctopus mimicussame family12.2%Octopus joubinisame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor21

Museum / vouchered25

Range

Area of Occupancy AOO128 km²

Depth

0–200 m sunlit7

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 30 m · 7 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 4≤1 km 8≤10 km 4>10 km 4

20 georeferenced · 1 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
University of Floridalocation not on record	1

2 institutions · 8 of 25 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Abdopus abaculus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)