Abdera flexuosa

(Paykull, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Melandryidae/Abdera

At a glance

Occurrence records1 481

Data sources7

Biological traits2

DNA specimens25

eDNA detections33

Sources7 archives

Databases and archives Abdera flexuosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 481 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 481 records

Environmental DNA3 datasets · 5 countries33 detections

DNA & barcodingBOLD25 specimens

01Narrative

Abdera flexuosa is a species of false darkling beetle (Melandryidae). (Paykull, 1799) It associates with plants: Alnus glutinosa — Black Alder Salix — Willow

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)fungivore

Feeding guild (larval)fungivore

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abdera flexuosa has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections33

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

271Cmostly conserved

AACTTTATATTTCATTTTTGGTGCTTGATCTGGTATATTAGGAACTTCATTAAGATTATTAATCCGATCAGAATTAGGAAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abdera affinissame genus10.5%Pectotoma hoppingisame order12.0%Paectes cyanodessame order13.1%Peribatodes perversariasame order13.2%Opisthoxia conjunctasame order13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 481 records

Wild obs. + sensor884

Museum / vouchered496

Cultivated / captive2

Other99

Origin

Native45

Range

Area of Occupancy AOO3 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 337≤1 km 177≤10 km 286>10 km 8

808 georeferenced · 76 without coordinates

Open the mapobservation + sensor884

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 172≤1 km 133≤10 km 132>10 km 5

442 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence496

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	227
Metsähallituslocation not on record	46
NTNU-VMlocation not on record	18
Dhaka, BD	18
Muzeum Górnośląskie w Bytomiulocation not on record	17
Trondheim, NO	16
Tallinn, EE	12
Helsinki, FI	11
Olocation not on record	10
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
Provincia di Livornolocation not on record	10
Tromsø, NO	9
NHMOlocation not on record	9
Tartu, EE	6
Kuopio, FI	6
neflocation not on record	6
BioFokuslocation not on record	5
LSMlocation not on record	5
Geneva, CH	4
ZSMlocation not on record	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	3
NMOKlocation not on record	3
NMBU:MINAlocation not on record	2
CBDClocation not on record	2
Zürich, CH	2
Salzburg, AT	2
NCMGlocation not on record	2
IFR-DNFlocation not on record	1
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	1

29 institutions · 466 of 496 vouchered records shown · 30 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA33 detections

Where the DNA of Abdera flexuosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys3

Countries5

Verifiable raw sequence linked9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map5 countries0

aus dem Detritus einer Sumpfwiese und aus mo…lepankaapapÃ¤hkinÃ¤lehto

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 5.20–14.4

Seasonal swing summer↔winter18.2 °C

Max temp (day)15.8 °C 8.90–18.8

Min temp (night)6.20 °C 1.20–10.4

Precipitation63.4 mm/mo 48.6–79.3

Air humidity60.3 % 57.3–62.9

Moisture balance-16.4 mm/mo -48.4–22.5

Vapour deficit542 Pa 332–657

Wind speed3.10 m/s 2.50–4.40

Cloud cover41.6 % 35.8–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abdera flexuosa

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 481 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 481 records