Abdera affinis

(Paykull, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Melandryidae/Abdera

At a glance

Occurrence records695

Data sources6

Biological traits2

DNA specimens16

eDNA detections37

Sources6 archives

Databases and archives Abdera affinis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility695 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF695 records

Environmental DNA3 datasets · 4 countries37 detections

DNA & barcodingBOLD16 specimens

01Narrative

Abdera affinis is een keversoort uit de familie zwamspartelkevers (Melandryidae). De wetenschappelijke naam van de soort werd in 1799 gepubliceerd door Gustaf von Paykull.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)fungivore

Feeding guild (larval)fungivore

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abdera affinis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections37

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

97Tmostly conserved

154Tvariable

181Amostly conserved

214Amostly conserved

319Amostly conserved

322Amostly conserved

347Tmostly conserved

421Avariable

460Tmostly conserved

475Tvariable

548Tmostly conserved

577Gvariable

625Amostly conserved

AACTTTATATTTTATTTTCGGTGCTTGATCAGGCATACTAGGAACTTCTTTAAGACTCCTTATTCGATCAGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.53%

Haplotypes8

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abdera flexuosasame genus10.5%Pectotoma hoppingisame order11.4%Ministrymon gammasame order13.7%Eucosma conformanasame order13.7%Coelocrossa hypocroceasame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type695 records

Wild obs. + sensor347

Museum / vouchered336

Other12

Origin

Native3

Range

Area of Occupancy AOO1 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 175≤1 km 75≤10 km 77>10 km 5

332 georeferenced · 15 without coordinates

Open the mapobservation + sensor347

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 114≤1 km 69≤10 km 70>10 km 10

263 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence336

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	115
Muzeum Górnośląskie w Bytomiulocation not on record	43
Metsähallituslocation not on record	29
Helsinki, FI	26
Kuopio, FI	23
NTNU-VMlocation not on record	13
NHMOlocation not on record	9
Olocation not on record	9
Trondheim, NO	8
Tartu, EE	6
TMPMlocation not on record	5
BioFokuslocation not on record	5
Provincia di Livornolocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
Oulu, FI	3
LSMlocation not on record	3
ZSMlocation not on record	3
Tallinn, EE	2
Bavarian State Collection of Zoologylocation not on record	2
neflocation not on record	2
IFR-DNFlocation not on record	1
Tromsø, NO	1
Rovaniemi, FI	1
NMOKlocation not on record	1
NCMGlocation not on record	1

25 institutions · 319 of 336 vouchered records shown · 17 without an institution code

09Environmental DNA37 detections

Where the DNA of Abdera affinis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys3

Countries4

Verifiable raw sequence linked19

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map4 countries0

Older mixed coniferous forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 9.20–15.1

Seasonal swing summer↔winter19.9 °C

Max temp (day)15.8 °C 11.4–19.2

Min temp (night)7.70 °C 4.50–11.1

Precipitation87.8 mm/mo 57.3–134

Air humidity60.0 % 57.5–64.7

Moisture balance-1.60 mm/mo -55.5–42.7

Vapour deficit560 Pa 410–698

Wind speed3.40 m/s 2.20–5.60

Cloud cover48.3 % 35.7–63.0

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)