Abagrotis discoidalis

Grote, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records145

Data sources6

Biological traits0

DNA specimens13

eDNA detections0

Sources6 archives

Databases and archives Abagrotis discoidalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility145 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF145 records

DNA & barcodingBOLD13 specimens

01Narrative

Abagrotis discoidalis is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1876. It is found North America in Washington, Oregon and California, west to northern Arizona and New Mexico, Colorado and north into southern Alberta. The wingspan is about 31 mm. Adults are on wing from June to August in Alberta. There is one generation per year.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis discoidalis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATCTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis vittifronssame genus1.7%Abagrotis duancasame genus2.0%Abagrotis turbulentasame genus2.0%Abagrotis scopeopssame genus2.0%Abagrotis dickelisame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor19

Museum / vouchered126

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 1≤1 km 4≤10 km 8>10 km 5

18 georeferenced · 1 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 6≤10 km 15

21 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	51
Oregon State Arthropod Collectionlocation not on record	22
Vernal, US	13
Helsinki, FI	9
ASUlocation not on record	8
Colorado State Universitylocation not on record	5
New Haven, US	3
Mississippi State, US	2
WWUlocation not on record	2
East Lansing, US	2
US	2
Cornell University Insect Collectionlocation not on record	1

12 institutions · 120 of 126 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)