Abacetus salzmanni

(Germar, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Abacetus

At a glance

Occurrence records261

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Abacetus salzmanni's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF261 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT2n = 42

01Narrative

Abacetus salzmanni is a species of ground beetle in the subfamily Pterostichinae. It was described by Ernst Friedrich Germar in 1824.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abacetus salzmanni has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes2

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes2

BIN1

Most divergent pair3.6%

Where individuals differ — all 24 variable positions, in barcode order

34Gvariable

43Gvariable

49Tvariable

50Cvariable

59Cvariable

142Tvariable

166Avariable

199Avariable

271Cvariable

391Avariable

424Tvariable

433Tvariable

448Cvariable

508Gvariable

517Gvariable

526Tvariable

535Cvariable

616Tvariable

622Avariable

625Tvariable

628Gvariable

631Avariable

634Cvariable

658Cvariable

AACTTTATATTTTATCTTTGGAGCATGAGCAGGGATAGTAGGGACTTCTCTAAGTATACTAATTCGAGCTGAATTAGGGAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblygnathus mexicanussame family8.1%Gnathaphanus philippensissame family8.2%Agonum monachumsame family8.4%Amblygnathus iripennissame family8.4%Amblygnathus puncticollissame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Abacetus salzmanni carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 411×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 421×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type261 records

Wild obs. + sensor134

Museum / vouchered127

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 19≤1 km 9≤10 km 45

73 georeferenced · 61 without coordinates

Open the mapobservation + sensor134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 1≤1 km 112≤10 km 4>10 km 2

119 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vitoria, ES	77
Natural History Museum Rotterdamlocation not on record	35
ZSMlocation not on record	2
NTNU-VMlocation not on record	2
Tartu, EE	2
Bavarian State Collection of Zoologylocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1

7 institutions · 120 of 127 vouchered records shown · 7 without an institution code

09Environmental DNA4 detections

Where the DNA of Abacetus salzmanni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 20.0–21.7

Seasonal swing summer↔winter16.5 °C

Max temp (day)25.4 °C 24.9–25.4

Min temp (night)16.7 °C 13.9–16.7

Precipitation46.2 mm/mo 31.1–46.2

Air humidity54.6 % 54.2–54.6

Moisture balance-112 mm/mo -126–-112

Vapour deficit1,176 Pa 1,074–1,176

Wind speed2.20 m/s 2.20–2.70

Cloud cover37.4 % 30.1–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)