Abacena accincta

Felder, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abacena

At a glance

Occurrence records68

Data sources6

Biological traits0

DNA specimens101

eDNA detections97

Sources6 archives

Databases and archives Abacena accincta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics101 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 3 countries97 detections

DNA & barcodingBOLD101 specimens

01Narrative

Abacena accincta is a species moth of the family Erebidae. It is found in French Guiana, Costa Rica and in Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding101 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abacena accincta has left across the world's sequence archives.

At a glance

DNA specimens101

BINs3

Marker genes1

eDNA detections97

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus100 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

1Tmostly conserved

5Tmostly conserved

13Tmostly conserved

19Cmostly conserved

22Amostly conserved

31Cmostly conserved

38Tmostly conserved

46Tmostly conserved

49Cmostly conserved

50Cmostly conserved

55Tmostly conserved

59Cmostly conserved

64Cmostly conserved

70Cmostly conserved

79Tmostly conserved

82Tmostly conserved

85Tmostly conserved

89Gmostly conserved

101Gmostly conserved

112Cmostly conserved

127Tmostly conserved

130Tmostly conserved

133Amostly conserved

139Amostly conserved

184Amostly conserved

197Cmostly conserved

200Amostly conserved

202Cmostly conserved

206Tmostly conserved

212Cmostly conserved

223Tmostly conserved

256Amostly conserved

259Tmostly conserved

263Tmostly conserved

265Amostly conserved

271Tmostly conserved

277Amostly conserved

283Cmostly conserved

284Tmostly conserved

286Amostly conserved

298Amostly conserved

325Tmostly conserved

328Amostly conserved

334Amostly conserved

343Tmostly conserved

352Cmostly conserved

358Tmostly conserved

364Cmostly conserved

368Amostly conserved

370Amostly conserved

379Tmostly conserved

382Tmostly conserved

385Tmostly conserved

397Tmostly conserved

400Cmostly conserved

412Tmostly conserved

415Gmostly conserved

424Amostly conserved

433Gmostly conserved

439Tmostly conserved

451Tmostly conserved

460Tmostly conserved

479Cmostly conserved

484Cmostly conserved

499Cmostly conserved

514Amostly conserved

517Amostly conserved

526Amostly conserved

532Tmostly conserved

539Cmostly conserved

547Tmostly conserved

556Tmostly conserved

568Amostly conserved

574Tmostly conserved

586Cmostly conserved

607Amostly conserved

628Tmostly conserved

634Tmostly conserved

637Amostly conserved

TACTTTATATTTTATTTTCGGAATTTGAGCCGGAATATTAGGAACTTCCCTAAGTTTACTAATCCGAGCCGAATTAGGTAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes9

BINs3

Most divergent pair12.3%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pyrgion repandasame order9.1%Kunugia latipennissame order9.3%Pleromella optersame family9.6%Synaxis cervinariasame order9.6%Stiria satanasame family9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor50

Museum / vouchered18

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 30≤1 km 1≤10 km 1>10 km 3

35 georeferenced · 15 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Pennsylvanialocation not on record	4
Tapachula, MX	2

2 institutions · 6 of 18 vouchered records shown · 12 without an institution code

09Environmental DNA97 detections

Where the DNA of Abacena accincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.0–25.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.2 °C 25.5–28.2

Min temp (night)21.9 °C 20.7–23.1

Precipitation320 mm/mo 65.5–423

Air humidity71.2 % 65.1–75.5

Moisture balance167 mm/mo -98.3–295

Vapour deficit867 Pa 700–1,105

Wind speed2.00 m/s 1.20–3.80

Cloud cover31.5 % 15.3–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 95 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)