Zymoseptoria tritici

(Roberge ex Desm.) Quaedvl. & Crous · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Zymoseptoria

At a glance

Occurrence records482

Data sources10

Biological traits0

DNA specimens62

eDNA detections64

Sources10 archives

Databases and archives Zymoseptoria tritici's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility482 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF482 records

Environmental DNA4 datasets · 21 countries64 detections

DNA & barcodingBOLD · NCBI62 specimens

Genome at a glanceNCBI≈40 Mbp

01Narrative

Zymoseptoria tritici, synonyms Septoria tritici, Mycosphaerella graminicola, is a species of filamentous fungus, an ascomycete in the family Mycosphaerellaceae. It is a wheat plant pathogen causing septoria leaf blotch that is difficult to control due to resistance to multiple fungicides. The pathogen today causes one of the most important diseases of wheat. In 2011, Quaedvlieg et al. introduced a new combination for this species: Zymoseptoria tritici (Desm.) Quaedvlieg & Crous, 2011, as they found that the type strains of both the genus Mycosphaerella (linked to the anamorph genus Ramularia) and the genus Septoria (linked to the genus Septoria, an extensive clade of very distinct septoria-like species within the Mycosphaerellaceae) clustered separately from the clade containing both Zymoseptoria tritici and Z. passerinii. Since 2011, a total of eight Zymoseptoria species have been described within the genus Zymoseptoria; Z. tritici (the type of the genus Zymoseptoria), Z. pseudotritici, Z. ardabiliae, Z. brevis, Z. passerinii, Z. halophila, Z. crescenta and Z. verkleyi (Named after Gerard J.M. Verkleij, for the contribution that he has made to further the understanding of the genus Septoria).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Zymoseptoria tritici across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Thiazole alkaloids1

Simple indole alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(4S)-2-(2-Hydroxyphenyl)-4,5-dihydro-1,3-thiazole-4-carboxylic acid		present	LOTUS
Methyl indole-3-carboxylate		present	LOTUS

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zymoseptoria tritici has left across the world's sequence archives.

At a glance

DNA specimens62

Marker genes2

GenBank sequences10

eDNA detections64

Countries21

The DNA barcodea real sequence read deposited for this species

ITSPX872909.1 ↗501 bpMorocco · 2015

ACGT

CTGCGGAGGGATCATTACCGAGCGAGGGCCTCCGGGTCCGACCTCCAACCCTTTGTGAACACATCCCGTTGCTTCGGGGGCGACCCTGCC …

Zymoseptoria tritici isolate 74R5 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_010222 ↗ · 22 protein · 27 tRNA · 2 rRNA

cox3hypothetical proteinnad1cox1nad5nad4Lnad4nad6nad3nad2atp9cox2cytbatp6atp8small subunit ribosomal RNAlarge subunit ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceNCBI

The complete instruction manual Zymoseptoria tritici carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈40 010 131 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Zymoseptoria tritici0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

07Deep time~52.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin52.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type482 records

Wild obs. + sensor38

Museum / vouchered438

Cultivated / captive5

Other1

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤100 m 1≤1 km 1≤10 km 33

35 georeferenced · 3 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 3≤10 km 12

15 georeferenced · 423 without coordinates

Open the institutions mapphysical evidence438

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	143
Kensington, AU	9
Museo Entomologico de Leonlocation not on record	3
Canberra, AU	2
BDBClocation not on record	1
Hobart, AU	1
Karlsruhe, DE	1

7 institutions · 160 of 438 vouchered records shown · 236 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA64 detections

Where the DNA of Zymoseptoria tritici was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found64

Studies independent surveys4

Countries21

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 64 detections have coordinates

Open the map21 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 8.30–23.1

Seasonal swing summer↔winter21.0 °C

Max temp (day)22.9 °C 12.2–28.5

Min temp (night)12.2 °C 3.40–15.6

Precipitation33.0 mm/mo 5.50–93.2

Air humidity53.4 % 39.8–61.0

Moisture balance-112 mm/mo -130–-5.70

Vapour deficit1,202 Pa 466–1,940

Wind speed4.10 m/s 2.40–5.70

Cloud cover36.7 % 21.6–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)